View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_48 (Length: 265)
Name: NF3693_low_48
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 149 - 183
Target Start/End: Original strand, 42629065 - 42629099
Alignment:
| Q |
149 |
atgtatgtaatttaagtacaatattataattttta |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42629065 |
atgtatgtaatttaagtacaatattataattttta |
42629099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University