View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_50 (Length: 257)
Name: NF3693_low_50
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 246
Target Start/End: Original strand, 5384064 - 5384294
Alignment:
| Q |
20 |
aattacaaaaaccatatttttgttgttgacataaatcagatatcaaccatgcgcaattaaacagactaattgctcga----tcattatgaaacccaaaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5384064 |
aattacaaaaaccatatttttgttgttgacataaatcagatatcaaccatgcgcaattaaatagactaattgctcgatcgatcattatgaaacccaaaca |
5384163 |
T |
|
| Q |
116 |
tgtagcaaactcttctaaatgttttaacatattacatcttaaaggctggtgtaacacaaaaacaaatgattgagtcatatcagttcgggaaccatccctg |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
5384164 |
tgtagcaaactcttgtaaatgttttaacatattacatcttaaaggctggtgtaacacaaaaacaaatgtttgagtcatattagttcggaaaccatccctg |
5384263 |
T |
|
| Q |
216 |
accgttaccaataaaaagacacatgatgatg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5384264 |
accgttaccaataaaaagacacatgatgatg |
5384294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University