View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3693_low_52 (Length: 250)

Name: NF3693_low_52
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3693_low_52
NF3693_low_52
[»] chr2 (1 HSPs)
chr2 (1-225)||(36053015-36053239)


Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 36053239 - 36053015
Alignment:
1 accttaatttcttttataacacttaacagcatgtctattagcaggaatgttatgaagccagcacgattagaattggtatttttaaaaacaatactttttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
36053239 accttaatttcttttataacacttaacagcatgtctattagcaggaatgttatgaagccggcacgattagaattggtatttttaaaaacaatactttttc 36053140  T
101 tactccctatatataaaggtccacttgggaattggccgggaattaaaacttgaatttaaaaagtgttaagaagttgcaaattgatgaaaatctttcatgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
36053139 tactccctatatataaaggtccacttgggaattggccgggaattaaaacttcaatttaaaaagtgttaagaagttgcaaattgatgaaaatctttcatgg 36053040  T
201 tcaactctttctcttgagtgaatga 225  Q
    |||||||||||||||||||||||||    
36053039 tcaactctttctcttgagtgaatga 36053015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University