View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_56 (Length: 248)
Name: NF3693_low_56
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 5656341 - 5656583
Alignment:
| Q |
1 |
caggactcacatgcgtcaggatttactgt-gtccatatctggaagttgctttagtcgctggcacaagttaagtttggttgtgtctgaagtctgatgtgac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656341 |
caggactcacatgcgtcaggatttactgttgtccatatctggaagttgctttagtcgctggcacaagttaagtttggttgtgtctgaagtctgatgtgac |
5656440 |
T |
|
| Q |
100 |
aagcgtacatattctatgaactgcaatctcatactcatagtttggttaattagggactatagggtacttctatttttagtttttagtttcctttactata |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656441 |
aagcgtacatattctatgaactgcaatatcatactcatagtttggttaattagggactatagggtacttctatttttagtttttagtttcctttactata |
5656540 |
T |
|
| Q |
200 |
tatgatatgataattgtaagagtcctgaggttgtctgtgctgc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
5656541 |
tatgatatgataattgtaagagtcctgaggctgtgtgtgctgc |
5656583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University