View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_61 (Length: 238)
Name: NF3693_low_61
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_61 |
 | |
|
| [»] scaffold0066 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 65 - 141
Target Start/End: Complemental strand, 34264078 - 34264002
Alignment:
| Q |
65 |
gaagaatgttgaattataaatatgaagagcaattggaatttgattcaattgtaaaaatgtggatgtgaatgaattga |
141 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34264078 |
gaagaattttgaattataaatatgaagagcaattggaatttgattcaattgtaaaaatatggatgtgaatgaattga |
34264002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 82 - 139
Target Start/End: Complemental strand, 53225512 - 53225455
Alignment:
| Q |
82 |
aaatatgaagagcaattggaatttgattcaattgtaaaaatgtggatgtgaatgaatt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
53225512 |
aaatatgaagagcaattggaatttgattcaattgaaaaaatatggatgcaaatgaatt |
53225455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 41855 - 41798
Alignment:
| Q |
167 |
ttaaaattcagactagtcatcaactcgatcaatgtactaagttcttgatcgaataact |
224 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||| || ||||||||| |||| |
|
|
| T |
41855 |
ttaaaaatcagactagttttcaactcgatcaatgtactaggtcattgatcgaacaact |
41798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 11441114 - 11441057
Alignment:
| Q |
167 |
ttaaaattcagactagtcatcaactcgatcaatgtactaagttcttgatcgaataact |
224 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||| || ||||||||| |||| |
|
|
| T |
11441114 |
ttaaaaatcagactagttttcaactcgatcaatgtactaggtcattgatcgaacaact |
11441057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University