View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_67 (Length: 227)
Name: NF3693_low_67
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 19 - 139
Target Start/End: Original strand, 106885 - 107005
Alignment:
| Q |
19 |
caggttacatagcttcatggctcgttcgttaccttctccatcgtggttacactgttaaagccaccgctcgcgacccaagtaattcattctcttctctttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
106885 |
caggttacatagcttcatggctcgttcgttaccttctccatcgtggttacactgttaaagccaccgttcgcgacccaagtaattcattctcttctctttt |
106984 |
T |
|
| Q |
119 |
gatctttataacacaaacact |
139 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
106985 |
gatctttataacacaaacact |
107005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 135 - 212
Target Start/End: Original strand, 107051 - 107128
Alignment:
| Q |
135 |
acactgaattaattaagtcattgtttaaagttaatgtgtctgcgtctacgtccgtgcttcataagttttgaccctatg |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| || ||||| || ||||||||||| |||||||||||||| |
|
|
| T |
107051 |
acacttaattaattaagtcattgtttaaagttaatgtgtatgtgtctatgttcgtgcttcatacgttttgaccctatg |
107128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 87515 - 87595
Alignment:
| Q |
19 |
caggttacatagcttcatggctcgttcgttaccttctccatcgtggttacactgttaaagccaccgctcgcgacccaagta |
99 |
Q |
| |
|
|||||||||| |||||||||||||| || | ||||| |||||||| ||||||||||||||||||| |||||| ||||||| |
|
|
| T |
87515 |
caggttacatcgcttcatggctcgtccgattgcttcttcatcgtggctacactgttaaagccaccgttcgcgatccaagta |
87595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University