View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_69 (Length: 218)
Name: NF3693_low_69
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 37385625 - 37385421
Alignment:
| Q |
1 |
caacttcatatcgacggttgctcggagcaatttccagccgtatggacgtgattttctgggtgggaagccaactgggagattcagcaatggtagaatagcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385625 |
caacttcatatcgacggttgctcggagcaatttccagccgtatggacgtgattttctgggtgggaagccaactgggagattcagcaatggtagaatagca |
37385526 |
T |
 |
| Q |
101 |
actgatttcatatcagaagcatttggtatcaaaccatacataccggcatacttggaccctagctttaacatctcacagtttgcaactggtgtctcctttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385525 |
actgatttcatatcagaagcatttggtatcaaaccatacataccagcatacttggaccctagctttaacatctcacagtttgcaactggtgtctcctttg |
37385426 |
T |
 |
| Q |
201 |
cttct |
205 |
Q |
| |
|
||||| |
|
|
| T |
37385425 |
cttct |
37385421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 36599072 - 36599127
Alignment:
| Q |
1 |
caacttcatatcgacggttgctcggagcaatttccagccgtatggacgtgattttc |
56 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
36599072 |
caacttcattccgacggttgcacggagcaattttcagccgtatggacgtgactttc |
36599127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University