View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_71 (Length: 211)
Name: NF3693_low_71
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 117
Target Start/End: Original strand, 42352797 - 42352900
Alignment:
| Q |
14 |
cctgtgaaggaattaagaggtggtgtcaaatttgctcctattggtttgataaatttgggagggggtgtcaatatcaaagagttcgattgctcgcttctga |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42352797 |
cctgtgaaggaattaagaggtggagtcaaatttgctcctattggtttgataaattcgagagggggtgtcaatatcaaagagttcggttgctcgcttctga |
42352896 |
T |
 |
| Q |
114 |
aacc |
117 |
Q |
| |
|
|||| |
|
|
| T |
42352897 |
aacc |
42352900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 42353719 - 42353767
Alignment:
| Q |
111 |
tgaaaccctaaccttgctcattctgaaatcaactttcaaatgtaagtat |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42353719 |
tgaaaccctaaccttgctcattctgaaatcaactttcaaatgtaagtat |
42353767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University