View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_73 (Length: 201)
Name: NF3693_low_73
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_73 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 11 - 183
Target Start/End: Complemental strand, 35212807 - 35212635
Alignment:
| Q |
11 |
gaagcaaagggcagaagctattatagatataagggaagcacaagaagataggaagaatcaagaccatagaaaatgggaagactggcttttggaggatgaa |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35212807 |
gaagcaaagagcagaagctattatagatataagggaagcacaagaagataggaagaatcaagaccatagaaaatgggaagactggcttttggaagatgaa |
35212708 |
T |
 |
| Q |
111 |
gatgttnnnnnnnnnnnnnnnnnnnnttcttcttcttgggagagtggaatgaaagattatagggaggagttac |
183 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212707 |
gatgttagcagcagcagcagcagcagttcttcttcttgggagagtggaatgaaagattatagggaggagttac |
35212635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University