View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_74 (Length: 201)
Name: NF3693_low_74
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 37317409 - 37317580
Alignment:
| Q |
17 |
agaatgtagtttttgttgttgaggataatgaactaagaatgcttattgcttatttcaattcgttgtatacatgcctatttatattaggtgtggctgcttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37317409 |
agaatgtagtttttgttgttgaggataatgaactaagaatgcttattgcttatttcaattcgttgtatacatgcctatttataataggtgtggctgcttt |
37317508 |
T |
 |
| Q |
117 |
gttcatttgtatatattgatttgtctaaagctgaagtttgttgaccaaaaacttttagatatatgtcaaaat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37317509 |
gttcatttgtatatattgatttgtctaaagctgaagtttgttgaccaaaaacttttagatatatgtcaaaat |
37317580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 67 - 188
Target Start/End: Original strand, 37321077 - 37321202
Alignment:
| Q |
67 |
tatttcaattcgtt-gtatacatgcctatttatat--taggtgtggctgctttgttcatttgtatatattg--atttgtctaaagctgaagtttgttgac |
161 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||| ||||||||||||||| ||||||||| |||| | || ||||| ||||||| |||| ||||| |
|
|
| T |
37321077 |
tatttcaattggtttggatacatgcctatttatataataggtgtggctgcttctttcatttgtttataatattatctgtctcaagctgatgtttcttgac |
37321176 |
T |
 |
| Q |
162 |
caaaaacttttagatatatgtcaaaat |
188 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
37321177 |
caaaaac-tttagatatatgtcaaaat |
37321202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University