View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3695_high_15 (Length: 238)
Name: NF3695_high_15
Description: NF3695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3695_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 86 - 222
Target Start/End: Original strand, 3200873 - 3201009
Alignment:
| Q |
86 |
cagacaaactaatttatcttcggcataagaatgtacaccgactaaattgtgaaggacaaaattggatattcaaacgaaatttatctaaattgtgaaggac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3200873 |
cagacaaactaatttatcttcggcataagaatgtacactgactaaattatgaaggacgaaattgaatattcaaacgaaatttatctaaattgtgaaggac |
3200972 |
T |
 |
| Q |
186 |
gaaattgggtatttacacgaaaatagattcatatttc |
222 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3200973 |
gaaattgggtattcacacgaaaatatattcatatttc |
3201009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University