View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3695_low_16 (Length: 240)
Name: NF3695_low_16
Description: NF3695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3695_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 85 - 223
Target Start/End: Complemental strand, 37021471 - 37021333
Alignment:
| Q |
85 |
ggttctgagatattgatttggttcgtnnnnnnntgtgccacgatcagaaggaatagtggcacaattttggataaggctggcagcaatattgggcacgagt |
184 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
37021471 |
ggttttgagatattgatttggttcgtaaaaaaacgtgccacgatcagaaggaatagtggcacaattttggataaggctgacagcaatattgggtacgagt |
37021372 |
T |
 |
| Q |
185 |
agaagatcgtgatacaatcttgacaattcatggtgcaat |
223 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37021371 |
tgaagatcgtgacacaatcttgacaattcatggtgcaat |
37021333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 37021960 - 37021932
Alignment:
| Q |
19 |
aatgtagttataataatttgaagttaggt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37021960 |
aatgtagttataataatttgaagttaggt |
37021932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University