View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3696_high_10 (Length: 365)
Name: NF3696_high_10
Description: NF3696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3696_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 2817710 - 2817483
Alignment:
| Q |
1 |
tcatcccacaagtctctctatcccttcactacttcttcttacggttcaagccttttctccattgttattttttattatcatcatttctttcttgctttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817710 |
tcatcccacaagtctctctatcccttcactacttctt---acggttcaagccttttctccattgttattttttattatcatcatttctttcttgctttta |
2817614 |
T |
 |
| Q |
101 |
ctaatttcatgttcatggattctacatttttgtatacaatttnnnnnnnnnnnntatagtgtggcgacgagccgaattgatagagttttcctatcggaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817613 |
ctaatttcatgttcatggattctacatttttgtatacaatttcacacacacacatatagtgtggcgacgagccgaattgatagagttttcctatcggaag |
2817514 |
T |
 |
| Q |
201 |
agtgggtgaatatgtggggaagtctgtctct |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2817513 |
agtgggtgaatatgtggggaagtctgtctct |
2817483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 253 - 350
Target Start/End: Complemental strand, 2817451 - 2817354
Alignment:
| Q |
253 |
tgccctttgatcctaaaagttggcgaagcggattggggtcctaaacatttttgcttcaacaatcattggattgaattgaaaattggaaatctaaaaag |
350 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817451 |
tgccctttgatcctaaaggttggcgaagcggattggagtcctaaacatttttgcttcaacaatcattggattgaattgaaaattggaaatctaaaaag |
2817354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 231
Target Start/End: Complemental strand, 26477704 - 26477646
Alignment:
| Q |
173 |
cgaattgatagagttttcctatcggaagagtgggtgaatatgtggggaagtctgtctct |
231 |
Q |
| |
|
||||||||||| || ||| | | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26477704 |
cgaattgatagggtgttcattttggacgagtgggtgaatatgtggggaagtctgtctct |
26477646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 220
Target Start/End: Original strand, 24567600 - 24567646
Alignment:
| Q |
174 |
gaattgatagagttttcctatcggaagagtgggtgaatatgtgggga |
220 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
24567600 |
gaattgatagagttgttgtatcggaagagtgggtgaatttgtgggga |
24567646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University