View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3696_high_15 (Length: 281)
Name: NF3696_high_15
Description: NF3696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3696_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 135 - 200
Target Start/End: Original strand, 4298103 - 4298168
Alignment:
| Q |
135 |
tctttttcttgaatagaacaagcaattctcattgtcattataatatgaggctaaaaattaatagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4298103 |
tctttttcttgaatagaacaagcaatactcattgtcattattatatgaggccaaaaattaatagtt |
4298168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 94 - 135
Target Start/End: Original strand, 4298043 - 4298084
Alignment:
| Q |
94 |
cctaatctcatgccttattaatattcctttgcaaaacatagt |
135 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4298043 |
cctaatttcatgccttattaatattcctttgcaaaacatagt |
4298084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 66 - 136
Target Start/End: Original strand, 30696504 - 30696581
Alignment:
| Q |
66 |
ttagtggtccatcaatgtgatattggaac-------ctaatctcatgccttattaatattcctttgcaaaacatagtc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30696504 |
ttagtggtccatcaatgtgatattggaatttgaaagctaatcgcatgccttattaacattcctttgcaaaacatagtc |
30696581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 64
Target Start/End: Original strand, 30696402 - 30696455
Alignment:
| Q |
11 |
caaaggttaacgaaccctcatgcatgtgcttattaattaatattagagcctaat |
64 |
Q |
| |
|
||||||||||| ||| |||||| | |||||| | |||||||||||||||||||| |
|
|
| T |
30696402 |
caaaggttaacaaactctcatgtacgtgcttgtaaattaatattagagcctaat |
30696455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 135
Target Start/End: Complemental strand, 24073262 - 24073212
Alignment:
| Q |
85 |
atattggaacctaatctcatgccttattaatattcctttgcaaaacatagt |
135 |
Q |
| |
|
||||| || ||||||| |||||||| |||||||||||| |||||||||||| |
|
|
| T |
24073262 |
atattagagcctaatcacatgcctttttaatattccttagcaaaacatagt |
24073212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University