View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3696_low_27 (Length: 210)
Name: NF3696_low_27
Description: NF3696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3696_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 55695975 - 55696159
Alignment:
| Q |
13 |
catcacaatctctaaaacactatttactgactgaaatttgaaattcataggg--atcccatagaaactagggaaatggattctctcaattgggnnnnnnn |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55695975 |
catcacaatctctaaaacactatttactgactgaaatttgaaattcatagggatatcccatagaaactagggaaatggattctctcaattgggaaaaaaa |
55696074 |
T |
|
| Q |
111 |
ncttgaggaaataatgaggtgatcttaaccattgatctccatattatcaatggtcaagatcactgattaagatctctacattatt |
195 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55696075 |
acttgaggaaataatgaggagatcttaaccattgatctccatattatcaatggtcaagatcagtgattaagatctctacattatt |
55696159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 171
Target Start/End: Complemental strand, 7898204 - 7898163
Alignment:
| Q |
130 |
tgatcttaaccattgatctccatattatcaatggtcaagatc |
171 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
7898204 |
tgatcttgaccattgatctccacattatcaatggtcaagatc |
7898163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 163
Target Start/End: Complemental strand, 26919532 - 26919500
Alignment:
| Q |
131 |
gatcttaaccattgatctccatattatcaatgg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26919532 |
gatcttaaccattgatctccatattatcaatgg |
26919500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University