View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3696_low_7 (Length: 430)
Name: NF3696_low_7
Description: NF3696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3696_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 53482247 - 53482056
Alignment:
| Q |
19 |
gtggaaacgccgcaaaatccacatgaggtgttaagcgataacatttcactcaaattgattgattgttccttttttccattaaacaacgatgggatggaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53482247 |
gtggaaacgccgcaaaatccacatgaggtattaagcgataacatttcactcaaattgattgattgttccttttttccattaaacaacgatgggatggaag |
53482148 |
T |
 |
| Q |
119 |
ataatactactacctcttcattgtcactacacactagagcttccgcatgaaaactcgtgtcattcaattcttcttcctttttattttgagag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53482147 |
ataatactactacctcttcattgtcactacacactagagcttccgcatgaaaactcgtgtcattcaattcttcttcctttttattttgagag |
53482056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 354 - 418
Target Start/End: Complemental strand, 53481911 - 53481847
Alignment:
| Q |
354 |
ataagacttgttcgtccatgtttgctctcttctttattttgcgtgaagttaccatgttttgtttc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53481911 |
ataagacttgttcgtccatgtttgctctcttttttattttgcgtgaagttaccatgttttgtttc |
53481847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University