View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3697_high_10 (Length: 313)
Name: NF3697_high_10
Description: NF3697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3697_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 861897 - 861591
Alignment:
| Q |
1 |
tcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
861897 |
tcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatatt |
861798 |
T |
 |
| Q |
101 |
gctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
861797 |
gctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctac |
861698 |
T |
 |
| Q |
201 |
atttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
861697 |
atttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccct |
861598 |
T |
 |
| Q |
301 |
atgcttc |
307 |
Q |
| |
|
|||||| |
|
|
| T |
861597 |
ctgcttc |
861591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 1223174 - 1222868
Alignment:
| Q |
1 |
tcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223174 |
tcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatatt |
1223075 |
T |
 |
| Q |
101 |
gctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223074 |
gctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctac |
1222975 |
T |
 |
| Q |
201 |
atttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1222974 |
atttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccct |
1222875 |
T |
 |
| Q |
301 |
atgcttc |
307 |
Q |
| |
|
|||||| |
|
|
| T |
1222874 |
ctgcttc |
1222868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University