View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3697_high_18 (Length: 248)
Name: NF3697_high_18
Description: NF3697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3697_high_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 3923558 - 3923323
Alignment:
| Q |
13 |
acatatacaactaatttgaataattcgaacgatgtggatttaagatttgatgatgtacctgcagatgatagatgggtggatcttaataggcctggaatta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923558 |
acatatacaactaatttgaataattcgaacgatgtggatataagatttgatgatgtacctgcagatgatagatgggtggatcttaataggcctggaatta |
3923459 |
T |
|
| Q |
113 |
ttgagaatgcaagggaggtgaagtttgctagtaagattcatttgaggatttctttgaatggtggttatcatgtgtcggacgagcctctcgaatatagtag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923458 |
ttgagaatgcaagggaggtgaagtttgctagtaagattcatttgaggatttctttgaatggtggttatcatgtgtcggacgagcctctcgaatatagtag |
3923359 |
T |
|
| Q |
213 |
cgactttaggccttcatcaagagatcattggccacc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923358 |
tgactttaggccttcatcaagagatcattggccacc |
3923323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University