View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3697_high_20 (Length: 230)
Name: NF3697_high_20
Description: NF3697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3697_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 1965514 - 1965302
Alignment:
| Q |
1 |
gatttgaatagatttgaatggaatttaaggaatgttcaaatggaagagtttatgaaagttaagaataataataaagggaacattaggtttgagattttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1965514 |
gatttgaatagatttgaatggaatttaaggaatgttcaaatggaagagtttatgaaagttaaaaataataataaagggaacattaggtttgaaattttgg |
1965415 |
T |
 |
| Q |
101 |
atgtaacaaatgcaatgatgatgagaccagatggacatcctggtcaacattggggaaataaatggatgaaaggttataatgattgtactcattggtgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965414 |
atgtaacaaatgcaatgatgatgagaccagatggacatcctggtcaacattggggaaataaatggatgaaaggttataatgattgtactcattggtgttt |
1965315 |
T |
 |
| Q |
201 |
gcctggtgctatt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1965314 |
gcctggtgctatt |
1965302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University