View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3697_low_29 (Length: 214)
Name: NF3697_low_29
Description: NF3697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3697_low_29 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 9999048 - 9999261
Alignment:
| Q |
1 |
taaactaatctcattattattattcacttacaccattatagtgcacaagctgtttgatagaatgcttgaattgttgcatttcggaaaggggaaaaaatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9999048 |
taaactaatctcattattattattcacttacaccattatagtgcacaagctgtttgatagaatgcttgaattgttgcatttcggaaaggggaaaaaatgt |
9999147 |
T |
|
| Q |
101 |
ggtggtttggtgtgaatttctagaacatgttttcactaatttttgaagtggctaatacatttatagaagcttaactaataaaataagtgtagcagagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9999148 |
ggtggtttggtgtgaatttctagaacatgttttcactaatttttgaagtggctaatacatttatagaagcttaactaataaaataagtgtagcagagatg |
9999247 |
T |
|
| Q |
201 |
atagagatgatgat |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9999248 |
atagagatgatgat |
9999261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University