View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3700_high_5 (Length: 286)
Name: NF3700_high_5
Description: NF3700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3700_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 36 - 276
Target Start/End: Original strand, 43488465 - 43488705
Alignment:
| Q |
36 |
taaaacacttaatgcatgtctgaaatcacgttgagttgatgaaatcatggtggtcttaccgtaatattattgaataaaattacggtgactcactgagatt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43488465 |
taaaacacttaatgcatgtctgaaatcacgttgagttgatgaaatcatgatggtctcaccgtaatattattgaataaaattacggtgactcgctgagatt |
43488564 |
T |
 |
| Q |
136 |
ctattaaacttaccatcaattcaaacatacggttaacttctatgttataagataagattaattggtgattgtgaaatcattgatatctcttgtaatagca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488565 |
ctattaaacttaccatcaattcaaacatacggttaacttctatgttataagataagattaattggtgattgtgaaatcattgatatctcttgtaatagca |
43488664 |
T |
 |
| Q |
236 |
ggaatgcaacttgaacttctagcaagcccaccacctttctt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488665 |
ggaatgcaacttgaacttctagcaagcccaccacctttctt |
43488705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University