View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3700_low_13 (Length: 217)
Name: NF3700_low_13
Description: NF3700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3700_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 53 - 200
Target Start/End: Original strand, 25378423 - 25378570
Alignment:
| Q |
53 |
ctttttgtagctcggcctaatgccaagtttgcgccgaaagtcaaatcaaaacagtccttacgaaaggaaatatctgcatcagaacatgctacctcgtctg |
152 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378423 |
ctttttgtagctcggcctagtgccaagtttgcgcccaaggtcaaatcaaaacagtccttacgaaaggaaatatctgcatcagaacatgctacctcgtctg |
25378522 |
T |
 |
| Q |
153 |
tagatgggaagaacatgcatgttgcttcaacccccacggtcactaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378523 |
tagatgggaagaacatgcatgttgcttcaacccccacggtcactaaat |
25378570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University