View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3701_high_24 (Length: 216)

Name: NF3701_high_24
Description: NF3701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3701_high_24
NF3701_high_24
[»] chr4 (1 HSPs)
chr4 (1-196)||(411514-411709)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 411514 - 411709
Alignment:
1 ctggtcagataagcattgatggaaaagtgaagtacggtacaccacaccttacatgtgtgggatcttttgctgtggatgtgagcttagaagggaatctgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
411514 ctggtcagataagcattgatggaaaagtgaagtacggtacaccacaccttacatgtgtgggatcttttgctgtggatgtgagcttagaagggaatctgat 411613  T
101 tttgtgcagacagattgatcaacctgggatgattggtactgtcggaaacatattaggcgagaaaaatgtgaatgtgagctttatgagcgttggaag 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
411614 tttgtgcagacagattgatcaacctgggatgattggtactgtcggaaacatattaggcgagaaaaatgtgaatgtgagctttatgagtgttggaag 411709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University