View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3701_low_16 (Length: 329)
Name: NF3701_low_16
Description: NF3701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3701_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 12 - 310
Target Start/End: Complemental strand, 54075555 - 54075257
Alignment:
| Q |
12 |
atcatcatcatcgcttccattatcatacaatatgaaattttccactcccacttttgaatgatacacaacccattccctcaaaaacttcgccacattataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075555 |
atcatcatcatcgcttccattatcatacaatatgaaattttccactcccacttttgaatgatacacaacccattccctcaaaaacttcgccacattataa |
54075456 |
T |
 |
| Q |
112 |
accatcgtgcatgcacaaaggaaatatttgggctgggccggaggcccaaacttttgaacagccacgggcttagaattgggtttattgggcctgggagtgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075455 |
accatcgtgcatgcacaaaggaaatatttgggctgggccggaggcccaaagttttgaactgccacgggcttagaattgggtttattgggcctgggagtgt |
54075356 |
T |
 |
| Q |
212 |
aatacgctacggacggaaccacgatgttttctccaataatctcgagggaaacaccaattttggaattcgaacccaaatcagacggatctggatgcaagc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075355 |
aatacgctacggacggaaccacgatgttttctccaataatctcgagggaaactccaatttcggaattcgaacccaaatcagacggatctggatgcaagc |
54075257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University