View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3702_high_5 (Length: 377)
Name: NF3702_high_5
Description: NF3702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3702_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 6 - 359
Target Start/End: Original strand, 40183462 - 40183815
Alignment:
| Q |
6 |
agcagcacagatagtaacaccctgaagtggcccttcatctttcaacatctgcaaagcattctcaacagtcttggaatgccccaacctaatatcccgttga |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40183462 |
agcatcacagatagtaacaccctgaagtgacccttcatctttcaacatctgcaaagcattctcaacagtcttggaatgtcccaacctaatatcccgttga |
40183561 |
T |
 |
| Q |
106 |
actctattaacatcatcagtatcaccgtaaatcttcttccatcgttgaaacccgttgttgttgaaatactccctcacaacttctttgtcatcaccgccta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183562 |
actctattaacatcatcagtatcaccgtaaatcttcttccatcgttgaaacccgttgttgttgaaatactccctcacaacttctttgtcatcaccgccta |
40183661 |
T |
 |
| Q |
206 |
cttcctccgcctgttcgcgtcgtcgtctttccgggtctgaaagggagagaagtgcggtgaggccagcgacgaagccgccgctgatgacggcgactgttgt |
305 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183662 |
cttcctccgcctgttcccgtcgtcgtctttccgggtctgaaagggagagaagtgcggtgaggccagcgacgaagccgccgctgatgacggcgactgttgt |
40183761 |
T |
 |
| Q |
306 |
gccgtctatggcgccggtaacgtcggcggctgttgcggttgagagtggagggat |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40183762 |
gccgtctatggcgccggtaacgtcggcggctgttgcggttgaaagtggagggat |
40183815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University