View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3702_low_14 (Length: 206)
Name: NF3702_low_14
Description: NF3702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3702_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 56165487 - 56165629
Alignment:
| Q |
18 |
acattctccatctcgccaccaatgcttttactaaaagcaagtttcttccatttaaagaaacctttcttcttctcaaccatcttttccatatgtgcttgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56165487 |
acattctccatctcgccaccaatgcttttactaaaagcaagtttcttccatttaaagaaacctttcttcttctcaaccatcttttccatatgtgcttgca |
56165586 |
T |
|
| Q |
118 |
tgacattgcactgactttgcagcctgtaaacatcttccttcag |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56165587 |
tgacattgcactgactttgcagcctgtaaacatcttccttcag |
56165629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 39 - 160
Target Start/End: Original strand, 44263770 - 44263891
Alignment:
| Q |
39 |
atgcttttactaaaagcaagtttcttccatttaaagaaacctttcttcttctcaaccatcttttccatatgtgcttgcatgacattgcactgactttgca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
44263770 |
atgcttttactaaaagcaagtttcttccatttgaagaaacttttcttcttctcagccatcttgtccatctgtgcttgcatgacattgcactgactctgca |
44263869 |
T |
|
| Q |
139 |
gcctgtaaacatcttccttcag |
160 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44263870 |
gcctgtaaacatcttccttcag |
44263891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University