View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3703_high_3 (Length: 241)
Name: NF3703_high_3
Description: NF3703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3703_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 100 - 221
Target Start/End: Complemental strand, 31934036 - 31933915
Alignment:
| Q |
100 |
cccaagggaactatttatatataatttcagtatttctattagacagcccttagtccagcatgcttggaatttgcatccttagtcccttttgccccatctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31934036 |
cccaagggaactatttatatataatttcagtatttctattagacagcccttagtcctgcatgcttggaatttgcatccttagtcccttttgccccatctg |
31933937 |
T |
|
| Q |
200 |
catcttccacaaacttccccag |
221 |
Q |
| |
|
|||||||| | |||||||||| |
|
|
| T |
31933936 |
catcttcctcgtacttccccag |
31933915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 31937080 - 31937044
Alignment:
| Q |
182 |
tcccttttgccccatctgcatcttccacaaacttccc |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31937080 |
tcccttttgccctatctgcatcttccacaaacttccc |
31937044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University