View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704R-Insertion-10 (Length: 290)
Name: NF3704R-Insertion-10
Description: NF3704R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704R-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 7416569 - 7416787
Alignment:
| Q |
9 |
attttgaggagaaagaatgccttttccaactctagcatttcgaagtagacatccattgttcatggattgtctattatggtgcctcattttattgtttgtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416569 |
attttgaggagaaagaatgccttttccaactctagcatttcgaagtagacatccattgttcatggattgtctattatggtgcctcattttattgtttgtt |
7416668 |
T |
|
| Q |
109 |
cagagaagtagttggtgtaaatgctacttctaattcaccatttatacgcaataatgtaattatactattactatgcagatttttgattgaaggaaaaaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416669 |
cagagaagtagttggtgtaaatgctacttctaattcaccatttatacgcaataatgtaattatactattactatgcagatttttgattgaaggaaaaaga |
7416768 |
T |
|
| Q |
209 |
tgcgatgcaatgcaatgca |
227 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
7416769 |
tgcaatgcaatgcaatgca |
7416787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 94 - 158
Target Start/End: Original strand, 52765575 - 52765639
Alignment:
| Q |
94 |
attttattgtttgttcagagaagtagttggtgtaaatgctacttctaattcaccatttatacgca |
158 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||| || ||||| |||||||| |||| |
|
|
| T |
52765575 |
attttattggtttttcagagaagtagttggtgtaaatgctagttgcaattctccatttatgcgca |
52765639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University