View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704R-Insertion-11 (Length: 254)
Name: NF3704R-Insertion-11
Description: NF3704R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704R-Insertion-11 |
 | |
|
| [»] scaffold0691 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0691 (Bit Score: 236; Significance: 1e-131; HSPs: 1)
Name: scaffold0691
Description:
Target: scaffold0691; HSP #1
Raw Score: 236; E-Value: 1e-131
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 2288 - 2533
Alignment:
| Q |
9 |
attatttccacttcttccttcctttttgtttatttaagtctttccctcccttcccctccmaactcccaaatagagcttaaaggttccctcttttgttctg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2288 |
attatttccacttcttccttcctttttgtttatttaagtctttccctcccttcccctccaaactcccaaatagagcttaaaggttccctcttttgttctg |
2387 |
T |
|
| Q |
109 |
ttttccttttttactctcttgagaccctaaactcgagctatctttttattaaattcatccagctcttaaaacttggcgactgaaaacagaaaaacgcaga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2388 |
ttttccttttttactctcttgagaccctaaactcgagctatctttttattaaattcatccagctcttaaaacttggcgactgaaaacagaagaacgcaga |
2487 |
T |
|
| Q |
209 |
attgcaccgcgtgttgcaagatacgccatagtaggactcccagcaa |
254 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2488 |
attgcaccgcgtgttgcaagatatgccatagtaggactcccagcaa |
2533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 78
Target Start/End: Original strand, 5825553 - 5825587
Alignment:
| Q |
44 |
aagtctttccctcccttcccctccmaactcccaaa |
78 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |
|
|
| T |
5825553 |
aagtccttccctcccttcccctccaaactcccaaa |
5825587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University