View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_high_11 (Length: 222)
Name: NF3704_1D_high_11
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 28 - 188
Target Start/End: Original strand, 42602873 - 42603032
Alignment:
| Q |
28 |
tgtgggcgagcgtgtcagtgctgggacgttggcatagcaatttggaccaacgttatgcactttagcattacactttgaaaaacaatgagnnnnnnnnnnn |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42602873 |
tgtgggcgagcgtgtcagtgctgggacgttggcatagcaatttggaccaacgttatgcactttagcattacactttgaaaaacaatgagaaaaaaacaaa |
42602972 |
T |
 |
| Q |
128 |
nnnnnnnntttgttcgaaaatatattttcacacaagtgtgatcatttagaaggtgaaacat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42602973 |
aaaatttc-ttgttcgaaaatatattttcacacaagtgtgatcatttagaaggtgaaacat |
42603032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University