View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_high_9 (Length: 249)
Name: NF3704_1D_high_9
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_high_9 |
 |  |
|
| [»] scaffold0072 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0072 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 44 - 237
Target Start/End: Original strand, 40426 - 40620
Alignment:
| Q |
44 |
tgttatggataagaccaaggtaattactgcagtaactaatgcagaaggtgaggaaggacagatgtcacataatccacagatacagggaccaagacgtgga |
143 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
40426 |
tgttatggataagaccaaggaaattactgcagtaactaatgcagaaggagaggaaggacagatgtcacgtaatccacagatccagggaccaagacgtgga |
40525 |
T |
 |
| Q |
144 |
atgaggcataggattcctaacagaaagttcactgaggactctgttaaataggacaatcattagcattgttaa-ggggaagaatatttggtagaat |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
40526 |
atgaggcatatgattcctaacagaaagttcaatgaggactctgttaaataggacaatcattagcattgttaagggggaataatatttggtagaat |
40620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072; HSP #2
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 44 - 237
Target Start/End: Original strand, 45258 - 45452
Alignment:
| Q |
44 |
tgttatggataagaccaaggtaattactgcagtaactaatgcagaaggtgaggaaggacagatgtcacataatccacagatacagggaccaagacgtgga |
143 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
45258 |
tgttatggataagaccaaggaaattactgcagtaactaatgcagaaggagaggaaggacagatgtcacgtaatccacagatccagggaccaagacgtgga |
45357 |
T |
 |
| Q |
144 |
atgaggcataggattcctaacagaaagttcactgaggactctgttaaataggacaatcattagcattgttaa-ggggaagaatatttggtagaat |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
45358 |
atgaggcatatgattcctaacagaaagttcaatgaggactctgttaaataggacaatcattagcattgttaagggggaataatatttggtagaat |
45452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University