View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_13 (Length: 291)
Name: NF3704_1D_low_13
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 15 - 291
Target Start/End: Complemental strand, 5950916 - 5950640
Alignment:
| Q |
15 |
tggacatcacaaattgggatccttctgaaattgctactatgattgaagcagagatatcaatgctacttccagataggacgaacagttatccagacgacga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5950916 |
tggacatcacaaattgggatccttctgaaattgctactatgattgaagcagagatatcaatgctacttccagataggacgaacagttatcaagacgacga |
5950817 |
T |
 |
| Q |
115 |
gaataatgcaagtcctcgtcgttatcatcattttccctctgtctcttctgtttcatcgtcacaagaatcattgtcgggtgcagtcaatagagctgatgac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5950816 |
gaataatgcaagtcctcgtcgttatcatcattttccctctgtctcttctgtttcatcgtcacaagaatcattgtcgggtgcagtcaatagagttgatgac |
5950717 |
T |
 |
| Q |
215 |
atatcaaatggatatcgctggcaccatggtacgtcttctttttcccttcacaagctatgttgtggatgtcctatttc |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950716 |
atatcaaatggatatcgctggcaccctggtacgtcttctttttcccttcacaagctatgttgtggatgtcctatttc |
5950640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University