View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_17 (Length: 270)
Name: NF3704_1D_low_17
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_17 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 12 - 265
Target Start/End: Original strand, 24494661 - 24494914
Alignment:
| Q |
12 |
atggacatcacttgaagcacacttcttctcaaaatctttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctctgcaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494661 |
atggacttcacttgaagcacacttcttctcaaaatctttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctctgcaca |
24494760 |
T |
|
| Q |
112 |
tgttacattttatggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagctgaatatagagctctagcatcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494761 |
tgttacattttatggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagctgaatatagagctctagcatcc |
24494860 |
T |
|
| Q |
212 |
gcatctgcagaagttctctggttgtcatcacttctctctgaacttcatatcagt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24494861 |
gcatctgcagaagttctctggttgtcatcacttctctctgaacttcatgtcagt |
24494914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 123 - 265
Target Start/End: Original strand, 86237 - 86379
Alignment:
| Q |
123 |
atggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagctgaatatagagctctagcatccgcatctgcaga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||| |
|
|
| T |
86237 |
atggtggtaacccaatttcttggaagtcttttaaacaaaaatttgttgcaagatcatccactgaagctgaatacagagctctagcatacgcatccgcaga |
86336 |
T |
|
| Q |
223 |
agttctctggttgtcatcacttctctctgaacttcatatcagt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
86337 |
agttctctggttgtcatcacttctctctgaacttcatgtcagt |
86379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 12 - 127
Target Start/End: Original strand, 94011 - 94126
Alignment:
| Q |
12 |
atggacatcacttgaagcacacttcttctcaaaatctttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctctgcaca |
111 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
94011 |
atggacttcacttgaagtgcacttcttctcaaaatctatatgcattcagtgatgccgattgggctggaaatcgagatgattatacatccacctctgcaca |
94110 |
T |
|
| Q |
112 |
tgttacattttatggt |
127 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
94111 |
tgttacattttatggt |
94126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 259
Target Start/End: Complemental strand, 18557131 - 18557084
Alignment:
| Q |
212 |
gcatctgcagaagttctctggttgtcatcacttctctctgaacttcat |
259 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18557131 |
gcatccgcagaagttctctggttgtcatcacttctctctgaacttcat |
18557084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University