View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_20 (Length: 251)
Name: NF3704_1D_low_20
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_20 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0072 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 251
Target Start/End: Complemental strand, 41154 - 40908
Alignment:
| Q |
5 |
tggtgtttcatagtaatcaaaaaattgctctgctcggaaaatccaattcatgacctcagatccatcaaatcgaggaaaatcgagtttaatgtgacgaacc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41154 |
tggtgtttcatagtaatcaaaaaattgctctgctcgaaaaatccaattcatgacctcagatccatcaaatcgaggaaaatcgagtttaatgtgacgaacc |
41055 |
T |
|
| Q |
105 |
tgaaatgggtgatggcttgcctggttggtttgagctgagttgttgctgttgttggaattctgggtagagtgcagtgaaataagctgattttcaacacgat |
204 |
Q |
| |
|
|||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41054 |
tgaaatgggtgatggcttgcctagctagtttgagctgagttgttgctgttgttggaattctgggtatagtgcagtgaaataagctgattttcaacacgat |
40955 |
T |
|
| Q |
205 |
caaagcgtgctaggtctacgtgacggtgttgagagtattcgttatgg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40954 |
caaagcgtgctaggtctacgtgacggtgttgagagtattcgttatgg |
40908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University