View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_21 (Length: 250)
Name: NF3704_1D_low_21
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 2 - 203
Target Start/End: Complemental strand, 15440012 - 15439811
Alignment:
| Q |
2 |
ccacaatatttttaaacttgtgatgttctttgcctttgtactcttgcaacagtgaggccgagacatgtcgagaccgtatttcaaaactagatccttcaac |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
15440012 |
ccacaatattttgaaacttgtgatgttcattgcctttagactcttgagacagtgaggccgagacatgtcgagactgtatttcgaaactagatccttcaac |
15439913 |
T |
|
| Q |
102 |
agggattgatgccattttaggtgaagccacacaccctgatggttgttttaatccaggtctttggactagagatttgactgaacttgactttgcattggcc |
201 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
15439912 |
agggattggtgtcattttaggtgaagccacacaccctgatggttgttttaatccaggtttttggactagagatttgactgaacttgacttagcattgacc |
15439813 |
T |
|
| Q |
202 |
tc |
203 |
Q |
| |
|
|| |
|
|
| T |
15439812 |
tc |
15439811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 15439798 - 15439699
Alignment:
| Q |
147 |
ttttaatccaggtctttggactagagatttgactgaacttgactttgcattggcctcatgttctcatgatttcaagggtcttcttaccccattatccatc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
15439798 |
ttttaatccaggtctttggactagagatttgactgaacctgacttagcattggcctcgggttttgatgatttcacgggttttcttaccccattatccatc |
15439699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 90 - 144
Target Start/End: Original strand, 11781751 - 11781805
Alignment:
| Q |
90 |
agatccttcaacagggattgatgccattttaggtgaagccacacaccctgatggt |
144 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| ||||||||| || |||||||| |
|
|
| T |
11781751 |
agatccttcagcggggattgatgccattttaggagaagccacatactctgatggt |
11781805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 153
Target Start/End: Complemental strand, 52418581 - 52418541
Alignment:
| Q |
113 |
ccattttaggtgaagccacacaccctgatggttgttttaat |
153 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
52418581 |
ccattttaggtgaagccgcacaccctgatggtggtgttaat |
52418541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University