View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_38 (Length: 214)
Name: NF3704_1D_low_38
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 2838694 - 2838500
Alignment:
| Q |
1 |
aaagttataggccatcactttcatttgaaacttgtgatgatccatcacaggcagaaagcatcgtatcaaatgtgaagaaagattgcgctgatgcagacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2838694 |
aaagttataggccatcactttcatttgaaacttgtgatgatccatcacaggcagaaagcatcgtatcaaatgtgaagaaagattgcgctgatgcagacca |
2838595 |
T |
|
| Q |
101 |
tggagaagaggtggaggaaaacagtcaacacaaggatcaagtgtgcaatgatatgcatagatccttttatgatactgagtctgatgttcttgatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2838594 |
tggagaagaggtggaggaaaacagtcaacacaaggatcaagcgtgcaatgatatgcatagatccttttatgatactgagtctgatgttcttgatg |
2838500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 148 - 199
Target Start/End: Complemental strand, 2842573 - 2842522
Alignment:
| Q |
148 |
atgatatgcatagatccttttatgatactgagtctgatgttcttgatgtcca |
199 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2842573 |
atgatttgcatagctccttttatgatactgagtctgatgttcttgatgtcca |
2842522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 2842705 - 2842671
Alignment:
| Q |
16 |
cactttcatttgaaacttgtgatgatccatcacag |
50 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
2842705 |
cactttcatttgaaacatgtgatgatccatcacag |
2842671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University