View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_42 (Length: 211)
Name: NF3704_1D_low_42
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_42 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 36951189 - 36951388
Alignment:
| Q |
12 |
atggacatcaggagcaaagtatgagggcgaattctccgggagttatcttcatggtcacggcacattcacaaaatcgaacggctgtgtttacacaggtgga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36951189 |
atggccatcaggagcaaagtatgagggcgaattctccgggagttatcttcatggtcacggcacattcacaaaatcgaacggctgtgtttacacaggtgga |
36951288 |
T |
 |
| Q |
112 |
tggaggatgaatgctcatcacgggattggacgaaaagtgtattccaattcagatatttacgaaggtttatggaaagaaggaattcgcgaaggcagcggaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36951289 |
tggaggatgaatgctcatcacgggattggacgaaaagcgtattccaattcagatatttacgaaggtttatggaaagaaggaattcgcgaaggcagcggaa |
36951388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University