View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3704_1D_low_42 (Length: 211)

Name: NF3704_1D_low_42
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3704_1D_low_42
NF3704_1D_low_42
[»] chr8 (1 HSPs)
chr8 (12-211)||(36951189-36951388)


Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 36951189 - 36951388
Alignment:
12 atggacatcaggagcaaagtatgagggcgaattctccgggagttatcttcatggtcacggcacattcacaaaatcgaacggctgtgtttacacaggtgga 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36951189 atggccatcaggagcaaagtatgagggcgaattctccgggagttatcttcatggtcacggcacattcacaaaatcgaacggctgtgtttacacaggtgga 36951288  T
112 tggaggatgaatgctcatcacgggattggacgaaaagtgtattccaattcagatatttacgaaggtttatggaaagaaggaattcgcgaaggcagcggaa 211  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36951289 tggaggatgaatgctcatcacgggattggacgaaaagcgtattccaattcagatatttacgaaggtttatggaaagaaggaattcgcgaaggcagcggaa 36951388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University