View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_43 (Length: 210)
Name: NF3704_1D_low_43
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_43 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 24 - 210
Target Start/End: Original strand, 45583951 - 45584137
Alignment:
| Q |
24 |
catatcatgtttcagaatggctgataccttacaatcgttgatggtgatagtatatattcattcaatatagacttattcactaccactcagtcgacagtgt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45583951 |
catatcatgtttcagaatggctgataccttacaatcgttgatggtgatagtatatattcattcaatatagacttattcactaccactcagtcgacagtgt |
45584050 |
T |
 |
| Q |
124 |
cgttgatgttgatacgacacggtttcagttggatgataaaagaaactaaatatgaaaccaaaaatcttgtttcttttttcctttgca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45584051 |
cgttgatgttgatacgacacggtttcagttgaatgataaaagaaactaaatatgaaaccaaaaatcttgtttcttttttcctttgca |
45584137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University