View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704_1D_low_6 (Length: 373)
Name: NF3704_1D_low_6
Description: NF3704_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704_1D_low_6 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 204 - 373
Target Start/End: Original strand, 5605083 - 5605252
Alignment:
| Q |
204 |
tggtggcaggggcaatggcagaggcagacctgcatattcctccactttgctggggggcaggcaatcaaggttggctcctgaattttctgggaggaaatca |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5605083 |
tggtggcaggggcaatggcagaggcagacctgcatattcctccactttgctggagggcaggcaatcaaggttggctcctgaattttctgggaggaaatca |
5605182 |
T |
|
| Q |
304 |
acgcggtttgcggccaagatgcattctggaatgccgagggtgactccaaacaaacatgctcacagtgctg |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5605183 |
acgcggtttgcggccaagatgcattctggaatgccgagggtgactccaaataaacatgctcacagtgctg |
5605252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 13 - 135
Target Start/End: Original strand, 5604892 - 5605014
Alignment:
| Q |
13 |
catcatcacaatcacaaaaatcaacaaaacagtagacatagtcaccatagtactcataaacgtcctagagaccgttggtcttcgtcttctaggcattatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5604892 |
catcatcacaatcacaaaaatcaacaaaacagtagacatagtcaccatagtactcataaacgtcctagagaccgttggtcttcgtcttctaggcactatt |
5604991 |
T |
|
| Q |
113 |
ccagctcaaactctgcaccttta |
135 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5604992 |
ccagctcaaactctgcaccttta |
5605014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 259 - 373
Target Start/End: Complemental strand, 5595774 - 5595660
Alignment:
| Q |
259 |
ggcaggcaatcaaggttggctcctgaattttctgggaggaaatcaacgcggtttgcggccaagatgcattctggaatgccgagggtgactccaaacaaac |
358 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5595774 |
ggcaggcaatcaaggttggctccggaattttctgggaggagatcaacgcggttcgcggccaagatgcattctggaatgccgagggtgactccaaacaaac |
5595675 |
T |
|
| Q |
359 |
atgctcacagtgctg |
373 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5595674 |
atgctcacagtgctg |
5595660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University