View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3705_low_1 (Length: 517)
Name: NF3705_low_1
Description: NF3705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3705_low_1 |
 |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (2 HSPs) |
 |  |  |
|
| [»] scaffold0396 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 2e-96; HSPs: 63)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 16 - 264
Target Start/End: Complemental strand, 30076213 - 30075965
Alignment:
| Q |
16 |
cttattcctcttgatcctgtttaataggattttggttgtatttgttttcctctttgcctcagtttctttgggaacaaggtacaacnnnnnnnnnnnnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30076213 |
cttattcctcttgatcctgtttaataggattttggttgtatttgttttcctctttggctcagtttctttgggaacaaggtacaacttttttgttttactt |
30076114 |
T |
 |
| Q |
116 |
nnnccccactcatagacccatttgtttgttgtgatttgcagactacttgttttcaatatcagttcattcttctgccgatgtgataaacgatctcatctgt |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30076113 |
tttccccactcatggacccatttgtttgttgtgatttgcagaccacttgttttcaatatcagttgattcttctgccgatgtgataaacgatctcatctgt |
30076014 |
T |
 |
| Q |
216 |
tattatgagattgaatggttcatattacacaataatgaaattaatttta |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30076013 |
tattatgagattgaatggttcatattacacaataatgaaattaatttta |
30075965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 373 - 473
Target Start/End: Original strand, 27392591 - 27392690
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27392591 |
aatatttttggatg-tgtttggatgttgttttgaaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccaaaccgaaccgcaaaagta |
27392689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 373 - 463
Target Start/End: Original strand, 1575843 - 1575932
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1575843 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
1575932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 387 - 473
Target Start/End: Original strand, 28694701 - 28694787
Alignment:
| Q |
387 |
gtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagtaa |
473 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
28694701 |
gtgtttggatgttgttatggaaaaaccgctatgatcggattggatttcggattgcgttttcaaaaccaaaccgaaccgcaatagtaa |
28694787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 373 - 459
Target Start/End: Complemental strand, 36482731 - 36482646
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccg |
459 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| |||||||| ||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
36482731 |
aatatttttggatg-tgtttggatgttgttttagaaaaaccactatgatcggatcggttttcggattgtcttttcaaaaccgaaccg |
36482646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 373 - 458
Target Start/End: Complemental strand, 323711 - 323627
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaacc |
458 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||||||||||||| || ||||||||||||| | |||||||||||||||| |
|
|
| T |
323711 |
aatatttttggatg-tgtttggatgttgttttggcaaaaccgctatgattggttcggatttcggatcaccttttcaaaaccgaacc |
323627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 389 - 469
Target Start/End: Complemental strand, 31280263 - 31280183
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaa |
469 |
Q |
| |
|
|||||||| |||||||| ||||| || || ||||||||||||||| |||| | ||||||||||||||||||||||||||| |
|
|
| T |
31280263 |
gtttggatgttgttttgtaaaaatcgttaagatcggatcggattttggatcactttttcaaaaccgaaccgaaccgcaaaa |
31280183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 389 - 459
Target Start/End: Complemental strand, 36582604 - 36582534
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccg |
459 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
36582604 |
gtttggatgttgttttgtaaaaaccgctaagatctgatcggatttcggatcactttttcaaaaccgaaccg |
36582534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 373 - 463
Target Start/End: Complemental strand, 6714317 - 6714228
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||| |||||||| ||||||||| || ||||| ||||||||||| ||||||||||||||||| || | || ||||||| |||||||||| |
|
|
| T |
6714317 |
aatatatttggatg-tgtttggatgttattttgtaaaaaccgctaggatcggatcggatttcgaatcactttctcaaaactgaaccgaacc |
6714228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 39832901 - 39832935
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39832901 |
ttttaggctaaaatatggttttagtccctgcaaat |
39832935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 45073309 - 45073343
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45073309 |
ttttaggctaaaatatggttttagtccctgcaaat |
45073343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 20388270 - 20388303
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20388270 |
tttaggctaaaatatggttttagtccctgcaaat |
20388303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 1006828 - 1006864
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1006828 |
aatttttggctaaaatatggttttagtccctgcaaat |
1006864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 23816667 - 23816699
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23816667 |
ttaggctaaaatatggttttagtccctgcaaat |
23816699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 261 - 293
Target Start/End: Original strand, 35014924 - 35014956
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35014924 |
tttaggctaaaatatggttttagtccctgcaaa |
35014956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 35015227 - 35015191
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35015227 |
aattataggctaaaatatggttttagtccctgcaaat |
35015191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 39719645 - 39719613
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39719645 |
ttaggctaaaatatggttttagtccctgcaaat |
39719613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 1559715 - 1559676
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1559715 |
attaattaaaggctaaaatatggttttagtccctgcaaat |
1559676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 17999723 - 17999692
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17999723 |
taggctaaaatatggttttagtccctgcaaat |
17999692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 21554755 - 21554724
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21554755 |
taggctaaaatatggttttagtccctgcaaat |
21554724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 25988379 - 25988414
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25988379 |
attttaggctaaaatatggttttggtccctgcaaat |
25988414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 28911575 - 28911606
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28911575 |
taggctaaaatatggttttagtccctgcaaat |
28911606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 30709654 - 30709615
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
30709654 |
attaatattaggctaaaatatgattttagtccctgcaaat |
30709615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 35838347 - 35838308
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
35838347 |
attatttttaggctaaaatatggttttggtccctgcaaat |
35838308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 45021858 - 45021827
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45021858 |
taggctaaaatatggttttagtccctgcaaat |
45021827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 6108333 - 6108363
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaat |
6108363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 6509207 - 6509237
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaat |
6509237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 8555800 - 8555770
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaat |
8555770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 373 - 431
Target Start/End: Original strand, 10286414 - 10286471
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggat |
431 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| ||||||||||| || || |||||| |
|
|
| T |
10286414 |
aatatttttggatg-tgtttggatgttgttttggcaaaaccgctataattggttcggat |
10286471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 11767280 - 11767246
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
11767280 |
ttttaggctaaaatatggttttggtccctgcaaat |
11767246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 12894403 - 12894373
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaat |
12894373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 13770082 - 13770052
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaat |
13770052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 14739005 - 14738975
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaat |
14738975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 19757747 - 19757777
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaat |
19757777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 21223749 - 21223719
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaat |
21223719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 23399607 - 23399641
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
23399607 |
ttttaggctaaaatatggttttggtccctgcaaat |
23399641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 28911907 - 28911877
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaat |
28911877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 31310680 - 31310650
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaat |
31310650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 37372905 - 37372875
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaat |
37372875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 41054241 - 41054207
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
41054241 |
ttttaggctaaaatatggttttggtccctgcaaat |
41054207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 44344790 - 44344760
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaat |
44344760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 44402959 - 44402989
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaat |
44402989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 44509055 - 44509025
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaat |
44509025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 46759653 - 46759687
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
46759653 |
ttttaggctaaaatatggttttggtccctgcaaat |
46759687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 1974009 - 1974038
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaat |
1974038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 3975842 - 3975809
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
3975842 |
tttaggctaaaatatggttttggtccctgcaaat |
3975809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 7431951 - 7431980
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaat |
7431980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 244 - 294
Target Start/End: Complemental strand, 10358391 - 10358339
Alignment:
| Q |
244 |
acaataatgaaattaatttta--ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
10358391 |
acaataatgaaatatattttaatggctaaaatatggttttagtccttgcaaat |
10358339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 13769774 - 13769803
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaat |
13769803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 17854145 - 17854178
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
17854145 |
tttagactaaaatatggttttagtccctgcaaat |
17854178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 17999465 - 17999494
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaat |
17999494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 19561154 - 19561183
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaat |
19561183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 19561450 - 19561421
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaat |
19561421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 25547490 - 25547461
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaat |
25547461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 253 - 294
Target Start/End: Complemental strand, 26878083 - 26878042
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||||||||| |
|
|
| T |
26878083 |
aaattatttataggctaaaatatggttttggtccctgcaaat |
26878042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 31732101 - 31732130
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaat |
31732130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 35210515 - 35210486
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaat |
35210486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 44508720 - 44508749
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaat |
44508749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 45021494 - 45021523
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaat |
45021523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 48359075 - 48359046
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaat |
48359046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 6079810 - 6079838
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaat |
6079838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 31310362 - 31310394
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
31310362 |
ttaggctaaaatatgattttagtccctgcaaat |
31310394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 31848206 - 31848174
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
31848206 |
ttaggctaaaatatgtttttagtccctgcaaat |
31848174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 85; Significance: 3e-40; HSPs: 65)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 373 - 473
Target Start/End: Original strand, 6345305 - 6345404
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6345305 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccaaaccgaaccgcaaaagta |
6345403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 373 - 473
Target Start/End: Complemental strand, 31127357 - 31127258
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31127357 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccaaaccgaaccgcaaaagta |
31127259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 373 - 473
Target Start/End: Complemental strand, 37949041 - 37948942
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37949041 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccaaaccgaaccgcaaaagta |
37948943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 373 - 463
Target Start/End: Complemental strand, 43620145 - 43620056
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43620145 |
aatatttttggatg-tgtttggatgttgctttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
43620056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 373 - 463
Target Start/End: Complemental strand, 26721264 - 26721175
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
26721264 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcttattttggattgcgttttcaaaaccgaaccgaacc |
26721175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 390 - 463
Target Start/End: Original strand, 1265121 - 1265194
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1265121 |
tttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccaaaccgaacc |
1265194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 373 - 458
Target Start/End: Complemental strand, 26721374 - 26721290
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaacc |
458 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
26721374 |
aatatttttggatg-tgtttggacgttgttttggaaaaaccgctatgatcaaatcagatttcggattgcgttttcaaaaccgaacc |
26721290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 373 - 463
Target Start/End: Original strand, 13470864 - 13470953
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| ||||| ||||||||||| |||||| |||| |||||||||||||||| |||| |
|
|
| T |
13470864 |
aatatttttggatg-tgtttggatgttgttttggaaaaaacgctacgatcggatcggttttcggtttgccttttcaaaaccgaaccaaacc |
13470953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 373 - 464
Target Start/End: Original strand, 32906903 - 32906993
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||||||||||||| || ||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
32906903 |
aatatttttggatg-tgtttggatgttgttttggcaaaaccgctatgattggttcggatttcggatcacattttcaaaaccgaaccaaaccg |
32906993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 373 - 473
Target Start/End: Original strand, 3106183 - 3106282
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||| |||| ||||| ||||||||| |||| | || ||||||||||||||||||||||||||| |
|
|
| T |
3106183 |
aatatttttggatgc-gtttggatgttgttttgtaaaaactgctaggatcgtatcggattttggatcactttctcaaaaccgaaccgaaccgcaaaagta |
3106281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 373 - 464
Target Start/End: Original strand, 4602596 - 4602686
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||||||| | ||||||||| ||||||||| |||||||||||||| || ||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
4602596 |
aatatttttggacg-tgtttggatgttgttttggcaaaaccgctatgattggttcggatttcggatcacattttcaaaaccgaaccaaaccg |
4602686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 464
Target Start/End: Original strand, 4267360 - 4267435
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||| || ||||| ||||||||||| ||||||||||||||| |||| | |||||||||||||||| ||||| |
|
|
| T |
4267360 |
gtttggatgttattttgtaaaaaccgctaagatcggatcggattttggatcaccttttcaaaaccgaaccaaaccg |
4267435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 28346768 - 28346729
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28346768 |
attaattttaggctaaaatatggttttggtccctgcaaat |
28346729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 294
Target Start/End: Complemental strand, 11019866 - 11019828
Alignment:
| Q |
256 |
ttaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11019866 |
ttaattttaggctaaaatatggttttggtccctgcaaat |
11019828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 16643652 - 16643690
Alignment:
| Q |
256 |
ttaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16643652 |
ttaaatttaggctaaaatatggttttagtccctgcaaat |
16643690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 24955015 - 24954981
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24955015 |
ttttaggctaaaatatggttttagtccctgcaaat |
24954981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 4376014 - 4375981
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4376014 |
tttaggctaaaatatggttttagtccctgcaaat |
4375981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 373 - 438
Target Start/End: Complemental strand, 42200174 - 42200110
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggat |
438 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||| |||||||| ||||||||||||| ||||||||| |
|
|
| T |
42200174 |
aatatttttagatg-tgtttggatgttgttttataaaaaccgttatgatcggatcgaatttcggat |
42200110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 16644051 - 16644015
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16644051 |
aatttaaggctaaaatatggttttagtccctgcaaat |
16644015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 1526174 - 1526143
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1526174 |
taggctaaaatatggttttagtccctgcaaat |
1526143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Original strand, 14495059 - 14495098
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14495059 |
attaattgaaggctaaaatatggttttagtccctgcaaat |
14495098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 18549199 - 18549230
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18549199 |
taggctaaaatatggttttagtccctgcaaat |
18549230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 19494117 - 19494148
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19494117 |
taggctaaaatatggttttagtccctgcaaat |
19494148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 29158352 - 29158383
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29158352 |
taggctaaaatatggttttagtccctgcaaat |
29158383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 33526418 - 33526383
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33526418 |
attttaggctaaaatatgattttagtccctgcaaat |
33526383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 33636320 - 33636351
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33636320 |
taggctaaaatatggttttagtccctgcaaat |
33636351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 35345623 - 35345588
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35345623 |
attttaggctaaaatatggttttagttcctgcaaat |
35345588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 423 - 466
Target Start/End: Complemental strand, 40619768 - 40619725
Alignment:
| Q |
423 |
ggatcggatttcggattgcgttttcaaaaccgaaccgaaccgca |
466 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
40619768 |
ggatcggattttggattgatttttcaaaaccgaaccgaaccgca |
40619725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 1408354 - 1408324
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaat |
1408324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 1525808 - 1525838
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaat |
1525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 7272419 - 7272449
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaat |
7272449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 10337114 - 10337148
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
10337114 |
ttttaggctaaaatatggttttggtccctgcaaat |
10337148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 14238750 - 14238780
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaat |
14238780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 14239081 - 14239051
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaat |
14239051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 16789074 - 16789104
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaat |
16789104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 19494414 - 19494384
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaat |
19494384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 21509923 - 21509889
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21509923 |
ttttaggctaaaatatgattttagtccctgcaaat |
21509889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 22650463 - 22650493
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaat |
22650493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 22917563 - 22917593
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaat |
22917593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 25131110 - 25131140
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaat |
25131140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 27341592 - 27341562
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaat |
27341562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 28323840 - 28323878
Alignment:
| Q |
256 |
ttaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
28323840 |
ttaatttaaggctaaaatatggttgtagtccctgcaaat |
28323878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 29488111 - 29488081
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaat |
29488081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 32418317 - 32418347
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaat |
32418347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 40066496 - 40066526
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaat |
40066526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 43477162 - 43477192
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaat |
43477192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 1162909 - 1162938
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaat |
1162938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 3512270 - 3512237
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
3512270 |
tttaggctaaaatatggttttggtccctgcaaat |
3512237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 4375692 - 4375721
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaat |
4375721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 10755528 - 10755499
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaat |
10755499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 10776499 - 10776470
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaat |
10776470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 15719656 - 15719685
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaat |
15719685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 16789369 - 16789340
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaat |
16789340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 28398756 - 28398785
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaat |
28398785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 33526052 - 33526081
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaat |
33526081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 253 - 294
Target Start/End: Complemental strand, 35115651 - 35115610
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
35115651 |
aaattaataataggctaaaatatggttttagtccctacaaat |
35115610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 40066820 - 40066791
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaat |
40066791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 40844156 - 40844185
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaat |
40844185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 3511899 - 3511935
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
3511899 |
aattttaggctaaaatatggttttggtcccttcaaat |
3511935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 4016906 - 4016934
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaat |
4016934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 4473701 - 4473733
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
4473701 |
ttaggctaaaatatggttttggtccctgcaaat |
4473733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 4710223 - 4710191
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
4710223 |
ttaggctaaaatatggttttggtccctgcaaat |
4710191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Complemental strand, 6146948 - 6146920
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaat |
6146920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 10337452 - 10337420
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
10337452 |
ttaggctaaaatatggttttggtccctgcaaat |
10337420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 261 - 289
Target Start/End: Complemental strand, 43477484 - 43477456
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43477484 |
tttaggctaaaatatggttttagtccctg |
43477456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 79; Significance: 1e-36; HSPs: 69)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 373 - 463
Target Start/End: Original strand, 40987340 - 40987429
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40987340 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
40987429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 373 - 473
Target Start/End: Original strand, 13521491 - 13521590
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13521491 |
aatatttttggatg-tgtttagatgttgttttggaataaccgctatgactagatcggatttcaaattgcattttcaaaaccgaaccgaaccgcaaaagta |
13521589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 389 - 469
Target Start/End: Original strand, 41061218 - 41061298
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaa |
469 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| ||||||| ||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
41061218 |
gtttggatattgttttgtaaaaaccgctaagatcggaacggattttggattactttttcaaaaccgaaccgaaacgcaaaa |
41061298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 373 - 463
Target Start/End: Original strand, 13554768 - 13554857
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||||||| || |||||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
13554768 |
aatatttttagatg-tgtttggatgttgttttggaaaaaccgctataattagatcggatttcgaattgcattttcaaaaccgaaccaaacc |
13554857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 373 - 469
Target Start/End: Original strand, 27110655 - 27110750
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaa |
469 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||| ||||||||||| |||||||||||||| |||| | ||| ||||||||||||||||||||||| |
|
|
| T |
27110655 |
aatatatttggatg-tgtttggatgttgttttgtaaaaaccgctaagatcggatcggattctggatcacttttccaaaaccgaaccgaaccgcaaaa |
27110750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 1495994 - 1495912
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaa |
456 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| ||||||||||| ||||||||||| |||||||| | |||||||||||||| |
|
|
| T |
1495994 |
aatatatttggatg-tgtttggatattgttttgtaaaaaccgctaagatcggatcgggtttcggatcaccttttcaaaaccgaa |
1495912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 464
Target Start/End: Original strand, 33160518 - 33160608
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| | ||||||| | ||||||||||||| | ||||||||| |||||| ||||| |
|
|
| T |
33160518 |
aatatttttggatg-tgtttggaggttgttttggaaaaactgttatgatcagttcggatttcggatcaccttttcaaaatcgaaccaaaccg |
33160608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 254 - 294
Target Start/End: Complemental strand, 6118510 - 6118470
Alignment:
| Q |
254 |
aattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6118510 |
aattaatttttggctaaaatatggttttagtccctgcaaat |
6118470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 29875735 - 29875696
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29875735 |
attatttttaggctaaaatatggttttagtccctgcaaat |
29875696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 31037751 - 31037712
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31037751 |
attaaatttaggctaaaatatggttttagtccctgcaaat |
31037712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 5614535 - 5614501
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5614535 |
ttttaggctaaaatatggttttagtccctgcaaat |
5614501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 5950171 - 5950205
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950171 |
ttttaggctaaaatatggttttagtccctgcaaat |
5950205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 10409331 - 10409297
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10409331 |
ttttaggctaaaatatggttttagtccctgcaaat |
10409297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 29692739 - 29692773
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29692739 |
ttttaggctaaaatatggttttagtccctgcaaat |
29692773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 28550815 - 28550856
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
28550815 |
aaattaaattttggctaaaatatggttttagtccctgcaaat |
28550856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 39379614 - 39379581
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39379614 |
tttaggctaaaatatggttttagtccctgcaaat |
39379581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 4203773 - 4203741
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4203773 |
ttaggctaaaatatggttttagtccctgcaaat |
4203741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 254 - 294
Target Start/End: Original strand, 5917115 - 5917155
Alignment:
| Q |
254 |
aattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
5917115 |
aattaattataggctaaaatatggttttggtccctgcaaat |
5917155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 18046351 - 18046319
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18046351 |
ttaggctaaaatatggttttagtccctgcaaat |
18046319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 25779165 - 25779133
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25779165 |
ttaggctaaaatatggttttagtccctgcaaat |
25779133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 257 - 293
Target Start/End: Complemental strand, 35166166 - 35166130
Alignment:
| Q |
257 |
taattttaggctaaaatatggttttagtccctgcaaa |
293 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35166166 |
taattttaggctataatatggttttagtccctgcaaa |
35166130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 3850293 - 3850328
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3850293 |
atttttggctaaaatatggttttagtccctgcaaat |
3850328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 19565837 - 19565802
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19565837 |
attttaggctaaaatatggttttggtccctgcaaat |
19565802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 23381948 - 23381979
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23381948 |
taggctaaaatatggttttagtccctgcaaat |
23381979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 25562001 - 25561970
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaat |
25561970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 28863844 - 28863809
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28863844 |
atttttggctaaaatatggttttagtccctgcaaat |
28863809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 30800492 - 30800523
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30800492 |
taggctaaaatatggttttagtccctgcaaat |
30800523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 30800852 - 30800821
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaat |
30800821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Original strand, 34125297 - 34125336
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
34125297 |
attatttttaggctaaaatatagttttagtccctgcaaat |
34125336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 35166905 - 35166940
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35166905 |
atttaaggctaaaatatggttttagtccctgcaaat |
35166940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 35877058 - 35877023
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35877058 |
attttaggctaaaatatggttttggtccctgcaaat |
35877023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 36577720 - 36577751
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36577720 |
taggctaaaatatggttttagtccctgcaaat |
36577751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 42994062 - 42994097
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42994062 |
atttttggctaaaatatggttttagtccctgcaaat |
42994097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 293827 - 293857
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
293827 |
aggctaaaatatggttttagtccctgcaaat |
293857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 2217493 - 2217523
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaat |
2217523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 2217855 - 2217825
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaat |
2217825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 4203455 - 4203485
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaat |
4203485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 5614165 - 5614195
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaat |
5614195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 7075571 - 7075601
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaat |
7075601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 10408927 - 10408957
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaat |
10408957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 10743723 - 10743753
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaat |
10743753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 11799128 - 11799158
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaat |
11799158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 14318040 - 14318074
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14318040 |
ttttaggctaaaatatggttttagtccttgcaaat |
14318074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 16038376 - 16038406
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaat |
16038406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 18046037 - 18046067
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18046037 |
aggctaaaatatggttttagtccctgcaaat |
18046067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 18633598 - 18633628
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaat |
18633628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 26133414 - 26133384
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaat |
26133384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 28863509 - 28863539
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaat |
28863539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 29172887 - 29172857
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaat |
29172857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 35167166 - 35167136
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaat |
35167136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 36578084 - 36578054
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaat |
36578054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 38496783 - 38496753
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaat |
38496753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 38786158 - 38786188
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaat |
38786188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 1104854 - 1104887
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
1104854 |
tttaggctaaaatatggttttggtccctgcaaat |
1104887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 1105152 - 1105119
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
1105152 |
tttaggctaaaatatggttttggtccctgcaaat |
1105119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 253 - 294
Target Start/End: Complemental strand, 13990907 - 13990866
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
13990907 |
aaatttatttaaggctaaaatacggttttagtccctgcaaat |
13990866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 18633961 - 18633932
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaat |
18633932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 21050913 - 21050884
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaat |
21050884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 23382297 - 23382268
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaat |
23382268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 25561705 - 25561734
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaat |
25561734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 29366949 - 29366920
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaat |
29366920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 32108804 - 32108837
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
32108804 |
tttaggctaaaatatggttttggtccctgcaaat |
32108837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 33336026 - 33335997
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaat |
33335997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 40029497 - 40029468
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaat |
40029468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 4736549 - 4736513
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
4736549 |
aatttaaggctaaaatatggttttggtccctgcaaat |
4736513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 29172524 - 29172552
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaat |
29172552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 31037388 - 31037424
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
31037388 |
aatttaagactaaaatatggttttagtccctgcaaat |
31037424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 265 - 293
Target Start/End: Original strand, 35165937 - 35165965
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35165937 |
ggctaaaatatggttttagtccctgcaaa |
35165965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 389 - 469
Target Start/End: Complemental strand, 42716209 - 42716129
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaa |
469 |
Q |
| |
|
|||||||| |||||||| ||||| |||| ||||| | ||||||||||| | |||||||||| ||||| |||||||||| |
|
|
| T |
42716209 |
gtttggatgttgttttgtaaaaaaagctaggatcgatttagatttcggattactttttcaaaactgaaccaaaccgcaaaa |
42716129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 1e-36; HSPs: 71)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 373 - 463
Target Start/End: Complemental strand, 24575263 - 24575174
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24575263 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
24575174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 373 - 463
Target Start/End: Original strand, 9279925 - 9280014
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9279925 |
aatatttttggatt-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
9280014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 373 - 472
Target Start/End: Complemental strand, 46252029 - 46251931
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |||||||||| || ||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
46252029 |
aatatttttggatg-tgtttggatgttgttttggaaaagccgctatgattggttcggatttcggatcaccttttcaaaaccgaaccgaaccgcaaaagta |
46251931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 373 - 464
Target Start/End: Complemental strand, 47498946 - 47498856
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||| || ||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
47498946 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgattggttcggatttcggatcacctttttaaaaccgaaccgaaccg |
47498856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 390 - 463
Target Start/End: Original strand, 7700297 - 7700370
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
7700297 |
tttggatgttgttttagaaaaaccgctatgatcggatcgaatttcagattgcgttttcaaaactgaaccgaacc |
7700370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 389 - 464
Target Start/End: Complemental strand, 42414640 - 42414565
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||||||| |||| | |||||||||||||||| ||||| |
|
|
| T |
42414640 |
gtttggatgttgttttgtaaaaaccgctaagatcggatcggattttggatcactttttcaaaaccgaaccaaaccg |
42414565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 373 - 451
Target Start/End: Complemental strand, 18781035 - 18780958
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaa |
451 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||||||| ||||||| |||| ||||||| ||| ||||||||||| |
|
|
| T |
18781035 |
aatatttttggatg-tgtttgaattttgttttggaaaaaccgttatgatcagatcagatttcgaattacgttttcaaaa |
18780958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 389 - 469
Target Start/End: Original strand, 34276963 - 34277043
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaa |
469 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||||| ||| |||| | ||||||||| ||||||||||||||||| |
|
|
| T |
34276963 |
gtttggatgttgttttgtaaaaaccgctaagatcggatcgaattctggatcactttttcaaaatcgaaccgaaccgcaaaa |
34277043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 389 - 464
Target Start/End: Original strand, 3756978 - 3757053
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
||||| || ||||||| |||||||| || |||||||||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
3756978 |
gtttgaatgttgttttttaaaaaccgttaagatcggatcggatttcggatcactttttcaaaaccgaaccaaaccg |
3757053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 390 - 473
Target Start/End: Original strand, 40436458 - 40436541
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagtaa |
473 |
Q |
| |
|
||||||| |||||||| ||||| | || |||| ||||||| ||||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
40436458 |
tttggatgttgttttgtaaaaattgttacgatcagatcggacttcggatcactttttcaaaaccaaaccgaaccgcaaaagtaa |
40436541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 389 - 464
Target Start/End: Original strand, 42430004 - 42430079
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||||| ||||||||| | ||||||||||| |||| ||||| |
|
|
| T |
42430004 |
gtttggatgttgttttgtaaaaaccgctcagatcggatcgaatttcggatcactttttcaaaaccaaaccaaaccg |
42430079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 13064154 - 13064188
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13064154 |
ttttaggctaaaatatggttttagtccctgcaaat |
13064188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 32365090 - 32365123
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32365090 |
tttaggctaaaatatggttttagtccctgcaaat |
32365123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 46088064 - 46088031
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46088064 |
tttaggctaaaatatggttttagtccctgcaaat |
46088031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 373 - 438
Target Start/End: Complemental strand, 47997095 - 47997031
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggat |
438 |
Q |
| |
|
||||||||| |||| || ||| || |||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
47997095 |
aatatttttcgatg-tgcttgaatgttgttttgtaaaaaccgctaggatcggatcggatttcggat |
47997031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 35763644 - 35763676
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35763644 |
ttaggctaaaatatggttttagtccctgcaaat |
35763676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 41346225 - 41346189
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41346225 |
aattgtaggctaaaatatggttttagtccctgcaaat |
41346189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 51708690 - 51708722
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51708690 |
ttaggctaaaatatggttttagtccctgcaaat |
51708722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 52430103 - 52430071
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52430103 |
ttaggctaaaatatggttttagtccctgcaaat |
52430071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 123532 - 123563
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
123532 |
taggctaaaatatggttttagtccctgcaaat |
123563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 4279016 - 4279051
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4279016 |
attttaggctaaaatatggttttagcccctgcaaat |
4279051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 9289264 - 9289295
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9289264 |
taggctaaaatatggttttagtccctgcaaat |
9289295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 13074131 - 13074096
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13074131 |
attttaggctaaaatatggttttggtccctgcaaat |
13074096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 13479613 - 13479582
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13479613 |
taggctaaaatatggttttagtccctgcaaat |
13479582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Original strand, 22099533 - 22099572
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22099533 |
attaatttatggctaaaatatggttttagtccctgcaaat |
22099572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 423 - 466
Target Start/End: Original strand, 24859057 - 24859100
Alignment:
| Q |
423 |
ggatcggatttcggattgcgttttcaaaaccgaaccgaaccgca |
466 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
24859057 |
ggatcggattttggattgatttttcaaaaccgaaccgaaccgca |
24859100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Original strand, 32208532 - 32208571
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
32208532 |
attaacttaaggctaaaatatggttttagtccctgcaaat |
32208571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 35415639 - 35415604
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35415639 |
atttttggctaaaatatggttttagtccctgcaaat |
35415604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 251 - 294
Target Start/End: Original strand, 45505586 - 45505629
Alignment:
| Q |
251 |
tgaaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45505586 |
tgaaatttctttaaggctaaaatatggttttagtccctgcaaat |
45505629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 50714234 - 50714269
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50714234 |
atttttggctaaaatatggttttagtccctgcaaat |
50714269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 52441761 - 52441792
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52441761 |
taggctaaaatatggttttagtccctgcaaat |
52441792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 53716919 - 53716950
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53716919 |
taggctaaaatatggttttagtccctgcaaat |
53716950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 2180219 - 2180249
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaat |
2180249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 259 - 289
Target Start/End: Complemental strand, 4211824 - 4211794
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4211824 |
attttaggctaaaatatggttttagtccctg |
4211794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 452
Target Start/End: Complemental strand, 6184152 - 6184090
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaac |
452 |
Q |
| |
|
||||||| |||||||| ||||| || || |||||||||||||||||||| | |||||||||| |
|
|
| T |
6184152 |
tttggatgttgttttgtaaaaatcgttaggatcggatcggatttcggatcactttttcaaaac |
6184090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 13064466 - 13064436
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaat |
13064436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 14594201 - 14594235
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
14594201 |
ttttaggctaaaatatggttttggtccctgcaaat |
14594235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 16712692 - 16712662
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaat |
16712662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 18205155 - 18205185
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaat |
18205185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 22099913 - 22099883
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaat |
22099883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 23778963 - 23778993
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaat |
23778993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 24474964 - 24474934
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaat |
24474934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 28809181 - 28809151
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaat |
28809151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 29380911 - 29380881
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaat |
29380881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 29463914 - 29463884
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaat |
29463884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 32365484 - 32365454
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaat |
32365454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 34361802 - 34361832
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaat |
34361832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 35464013 - 35464047
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
35464013 |
ttttaggctaaaatatggttttggtccctgcaaat |
35464047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 36701999 - 36702029
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaat |
36702029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 41345852 - 41345882
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaat |
41345882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 45474597 - 45474567
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaat |
45474567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 45505895 - 45505865
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaat |
45505865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 45593591 - 45593557
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
45593591 |
ttttaggctaaaatatggttttagtctctgcaaat |
45593557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 45619795 - 45619761
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45619795 |
ttttaggctaaaatatgtttttagtccctgcaaat |
45619761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 46115780 - 46115750
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaat |
46115750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 46128914 - 46128884
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaat |
46128884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 46292652 - 46292622
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaat |
46292622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 51545628 - 51545658
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaat |
51545658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 51709028 - 51708998
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaat |
51708998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 52017504 - 52017534
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaat |
52017534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 52017871 - 52017841
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaat |
52017841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 55072388 - 55072418
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaat |
55072418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 8191391 - 8191362
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaat |
8191362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 13631224 - 13631257
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
13631224 |
tttaggctaaaatatggttttggtccctgcaaat |
13631257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 14488191 - 14488158
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
14488191 |
tttaggctaaaatatggttttggtccctgcaaat |
14488158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 50714565 - 50714536
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaat |
50714536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 53717174 - 53717145
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaat |
53717145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 13479273 - 13479301
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaat |
13479301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 14487795 - 14487831
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
14487795 |
aattctaggctaaaatatggttttggtccctgcaaat |
14487831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 42823769 - 42823805
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
42823769 |
aattttaggctaaaatatgattttggtccctgcaaat |
42823805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 42824098 - 42824062
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
42824098 |
aatttttggctaaaatatggttttggtccctgcaaat |
42824062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 75; Significance: 3e-34; HSPs: 51)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 373 - 463
Target Start/End: Complemental strand, 7608388 - 7608299
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7608388 |
aatatttttggatt-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
7608299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 373 - 473
Target Start/End: Complemental strand, 16705456 - 16705364
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16705456 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcg-------gattgcgttttcaaaaccgaaccgaaccgcaaaagta |
16705365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 373 - 463
Target Start/End: Original strand, 21946710 - 21946799
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||||||| || || ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
21946710 |
aatattttttgatg-tgtttggatgttgttttggaaaaaccgctataattggttcggatttcggatcagcttttcaaaaccgaaccaaacc |
21946799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 389 - 472
Target Start/End: Complemental strand, 10484472 - 10484386
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaa---ccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||| |||| || |||||||||||||||||||| |||||||||||||| || |||||| |||||| |||||||||||||| |
|
|
| T |
10484472 |
gtttggatgttgtcttctaaaaaccgctatgatcggattggatttcggattgctttctcaaaactgccgaactgaaccgcaaaagta |
10484386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 1890458 - 1890423
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1890458 |
attttaggctaaaatatggttttagtccctgcaaat |
1890423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 373 - 464
Target Start/End: Complemental strand, 3901240 - 3901150
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| |||||||| | |||| ||| ||| ||||||| | |||| ||||||||||||||||| |
|
|
| T |
3901240 |
aatatttttggatg-tgtttggatgttgttttgccaaaaccgccaagatcagattggacttcggatcacttttttaaaaccgaaccgaaccg |
3901150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 6412209 - 6412247
Alignment:
| Q |
256 |
ttaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6412209 |
ttaattttaggctaaaatatggttttggtccctgcaaat |
6412247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 15116661 - 15116702
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
15116661 |
aaattatttttaggctaaaatatggttttagtcgctgcaaat |
15116702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 393 - 473
Target Start/End: Original strand, 10386171 - 10386249
Alignment:
| Q |
393 |
ggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagtaa |
473 |
Q |
| |
|
|||| |||||||| ||||||||||| |||| |||||||||||||| | ||||||||||||| || |||||||||||||| |
|
|
| T |
10386171 |
ggatgttgttttgtaaaaaccgctaggatcatatcggatttcggatcac-ttttcaaaaccgatcc-aaccgcaaaagtaa |
10386249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 14655376 - 14655408
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14655376 |
ttaggctaaaatatggttttagtccctgcaaat |
14655408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 23770442 - 23770410
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23770442 |
ttaggctaaaatatggttttagtccctgcaaat |
23770410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 25431857 - 25431825
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25431857 |
ttaggctaaaatatggttttagtccctgcaaat |
25431825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 34582895 - 34582863
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34582895 |
ttaggctaaaatatggttttagtccctgcaaat |
34582863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 2615870 - 2615901
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2615870 |
taggctaaaatatggttttagtccctgcaaat |
2615901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 7156162 - 7156131
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaat |
7156131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 12176649 - 12176614
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12176649 |
attttaggttaaaatatggttttagtccctgcaaat |
12176614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 19321137 - 19321102
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19321137 |
attttaggctaaaatatggttttggtccctgcaaat |
19321102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 24692981 - 24692950
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaat |
24692950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 317807 - 317841
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
317807 |
ttttaggctaaaatatagttttagtccctgcaaat |
317841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 494400 - 494434
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
494400 |
tttttggctaaaatatggttttagtccctgcaaat |
494434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 1007119 - 1007153
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
1007119 |
ttttaggctaaaatatggttttggtccctgcaaat |
1007153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 2373178 - 2373208
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaat |
2373208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 2616241 - 2616211
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaat |
2616211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 3356141 - 3356171
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaat |
3356171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 6468309 - 6468339
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaat |
6468339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 8681117 - 8681087
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaat |
8681087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 9896638 - 9896608
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaat |
9896608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 12612364 - 12612330
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12612364 |
ttttaggctaaaatatggtgttagtccctgcaaat |
12612330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 15076205 - 15076175
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaat |
15076175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 15117041 - 15117011
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15117041 |
aggctaaaatatggttttagtccctgcaaat |
15117011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 22822652 - 22822622
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaat |
22822622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 23502541 - 23502511
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaat |
23502511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 24273827 - 24273857
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaat |
24273857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 24274132 - 24274102
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaat |
24274102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 30928680 - 30928710
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaat |
30928710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 31167205 - 31167171
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
31167205 |
tttttggctaaaatatggttttagtccctgcaaat |
31167171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 33801744 - 33801714
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaat |
33801714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 1875490 - 1875531
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
1875490 |
aaattaattttaggctaaaatatagctttaatccctgcaaat |
1875531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 260 - 289
Target Start/End: Complemental strand, 6468648 - 6468619
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6468648 |
ttttaggctaaaatatggttttagtccctg |
6468619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 15962023 - 15962056
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
15962023 |
tttaggctaaaatatggttttagtccttgcaaat |
15962056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 15962389 - 15962360
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaat |
15962360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 17771911 - 17771940
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaat |
17771940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 19296407 - 19296378
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaat |
19296378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 21994407 - 21994374
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
21994407 |
tttaggctaaaatatggttttggtccctgcaaat |
21994374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 22543722 - 22543689
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
22543722 |
tttaggctaaaatatggttttggtccctgcaaat |
22543689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 34582529 - 34582558
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaat |
34582558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Complemental strand, 494751 - 494723
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaat |
494723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 18024378 - 18024346
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
18024378 |
ttaggctaaaatatggttttggtccctgcaaat |
18024346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 22543347 - 22543383
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
22543347 |
aattataggctaaaatatggttttggtccctgcaaat |
22543383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 23770162 - 23770190
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaat |
23770190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 31166871 - 31166899
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaat |
31166899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 3e-34; HSPs: 70)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 373 - 459
Target Start/End: Original strand, 14461716 - 14461801
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccg |
459 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14461716 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccg |
14461801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 373 - 473
Target Start/End: Original strand, 5559393 - 5559492
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5559393 |
aatatttttggatg-tgtttggatgttgttttggaaaaaccgccatgatcggatcagatttcggattgcattttcaaaaccaaaccgaaccgcaaaagta |
5559491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 387 - 453
Target Start/End: Complemental strand, 24064007 - 24063941
Alignment:
| Q |
387 |
gtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaacc |
453 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
24064007 |
gtgtatggatgttgttttggaaaaaccgctatgattggatcggatttcggatcactttttcaaaacc |
24063941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 464
Target Start/End: Original strand, 41074903 - 41074993
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||||||||||||| || ||| | ||||||||| | | ||||||||| |||||||||| |
|
|
| T |
41074903 |
aatatttttggatg-tgtttggatgttgttttgaaaaaaccgctatggtcagattgaatttcggatcacctcttcaaaaccaaaccgaaccg |
41074993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 464
Target Start/End: Complemental strand, 41198613 - 41198523
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
||||| |||||||| || |||||| |||||||| ||||||||||| |||||||||||||||||||| | ||| |||||| ||||| ||||| |
|
|
| T |
41198613 |
aatatatttggatg-tgattggatgttgttttgtaaaaaccgctaagatcggatcggatttcggatcacttttccaaaactgaaccaaaccg |
41198523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 254 - 294
Target Start/End: Original strand, 21391085 - 21391125
Alignment:
| Q |
254 |
aattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21391085 |
aatttattttaggctaaaatatggttttagtccctgcaaat |
21391125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 247 - 294
Target Start/End: Complemental strand, 32454313 - 32454265
Alignment:
| Q |
247 |
ataatgaaattaatt-ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
32454313 |
ataatgaaattatttattaggctaaaatatggttttagtccctgcaaat |
32454265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 255 - 294
Target Start/End: Original strand, 19622645 - 19622684
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19622645 |
attatttttaggctaaaatatggttttagtccctgcaaat |
19622684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 35005749 - 35005715
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005749 |
ttttaggctaaaatatggttttagtccctgcaaat |
35005715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 990382 - 990350
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
990382 |
ttaggctaaaatatggttttagtccctgcaaat |
990350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 13260324 - 13260292
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13260324 |
ttaggctaaaatatggttttagtccctgcaaat |
13260292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 22919677 - 22919713
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22919677 |
aattataggctaaaatatggttttagtccctgcaaat |
22919713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 48609597 - 48609565
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48609597 |
ttaggctaaaatatggttttagtccctgcaaat |
48609565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 11822367 - 11822336
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaat |
11822336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 423 - 466
Target Start/End: Complemental strand, 11956375 - 11956332
Alignment:
| Q |
423 |
ggatcggatttcggattgcgttttcaaaaccgaaccgaaccgca |
466 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
11956375 |
ggatcggattttggattgatttttcaaaaccgaaccgaaccgca |
11956332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 264 - 295
Target Start/End: Original strand, 12361010 - 12361041
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatt |
12361041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 13770487 - 13770518
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13770487 |
taggctaaaatatggttttagtccctgcaaat |
13770518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 15516576 - 15516611
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15516576 |
attttaggctaaaatatggttttggtccctgcaaat |
15516611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 18473270 - 18473301
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18473270 |
taggctaaaatatggttttagtccctgcaaat |
18473301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 464
Target Start/End: Original strand, 24614743 - 24614833
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
||||| |||||||| | ||||||| | |||||| ||||||||||| ||||||||| ||||| |||| | |||| ||||||||||| ||||| |
|
|
| T |
24614743 |
aatatatttggatgct-tttggatgtcgttttgtaaaaaccgctaagatcggatcagattttggatcacttttttaaaaccgaaccaaaccg |
24614833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 41358665 - 41358634
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41358665 |
taggctaaaatatggttttagtccctgcaaat |
41358634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 41739122 - 41739091
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaat |
41739091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 45290826 - 45290791
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45290826 |
attttaggctaaaatatggttttagtccccgcaaat |
45290791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 50799128 - 50799159
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaat |
50799159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 52254485 - 52254450
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52254485 |
atttttggctaaaatatggttttagtccctgcaaat |
52254450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 1810926 - 1810956
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaat |
1810956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 2604191 - 2604157
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2604191 |
ttttaggctaaaatatgtttttagtccctgcaaat |
2604157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 4360627 - 4360597
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaat |
4360597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 6567497 - 6567467
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaat |
6567467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 7001902 - 7001868
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
7001902 |
tttttggctaaaatatggttttagtccctgcaaat |
7001868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 7867124 - 7867158
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7867124 |
ttttaggctaaaatatggttttagtccttgcaaat |
7867158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 10887228 - 10887262
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
10887228 |
ttttaggctaaaatatggttttggtccctgcaaat |
10887262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 11822003 - 11822033
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaat |
11822033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 14007488 - 14007518
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaat |
14007518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 18079661 - 18079631
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaat |
18079631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 18302388 - 18302358
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaat |
18302358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 18473596 - 18473566
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaat |
18473566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 26061955 - 26061985
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaat |
26061985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 29072496 - 29072526
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaat |
29072526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 29072867 - 29072833
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29072867 |
tttttggctaaaatatggttttagtccctgcaaat |
29072833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 32626528 - 32626558
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaat |
32626558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 32729050 - 32729020
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaat |
32729020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 33379887 - 33379917
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaat |
33379917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 34002941 - 34002911
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaat |
34002911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 35005443 - 35005473
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaat |
35005473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 35307714 - 35307744
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaat |
35307744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 41358368 - 41358398
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaat |
41358398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 255 - 293
Target Start/End: Complemental strand, 41881356 - 41881318
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaa |
293 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41881356 |
attaattgaaggctaaaatatggttttagtccctgcaaa |
41881318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 45290456 - 45290486
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaat |
45290486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 45368489 - 45368519
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaat |
45368519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 22919981 - 22919948
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
22919981 |
tttaggctaaaatatggttttagtctctgcaaat |
22919948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 22953556 - 22953527
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaat |
22953527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 24649350 - 24649379
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaat |
24649379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 26191359 - 26191388
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaat |
26191388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 26191734 - 26191705
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaat |
26191705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 26442563 - 26442592
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaat |
26442592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 33067344 - 33067377
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
33067344 |
tttaggctaaaatatggttttagtccttgcaaat |
33067377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 35308111 - 35308082
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaat |
35308082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Original strand, 45380268 - 45380301
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
45380268 |
tttaggctaaaatatggttttggtccctgcaaat |
45380301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 48956066 - 48956037
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaat |
48956037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 50429213 - 50429180
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
50429213 |
tttaggctaaaatatgattttagtccctgcaaat |
50429180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 3753214 - 3753242
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaat |
3753242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 4323829 - 4323857
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaat |
4323857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 8140431 - 8140463
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
8140431 |
ttaggctaaaatatggttttggtccctgcaaat |
8140463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 10887601 - 10887569
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
10887601 |
ttaggctaaaatatggttttggtccctgcaaat |
10887569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 27521577 - 27521605
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaat |
27521605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 254 - 294
Target Start/End: Complemental strand, 31258713 - 31258673
Alignment:
| Q |
254 |
aattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31258713 |
aattgattttagcttaaaatatggttttagtccctgcaaat |
31258673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 34382948 - 34382976
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaat |
34382976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 44641079 - 44641107
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaat |
44641107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 45638897 - 45638865
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
45638897 |
ttaggctaaaatatggttttggtccctgcaaat |
45638865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 70; Significance: 2e-31; HSPs: 70)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 390 - 463
Target Start/End: Complemental strand, 37282737 - 37282664
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37282737 |
tttggatgttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
37282664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 390 - 463
Target Start/End: Complemental strand, 19636638 - 19636565
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19636638 |
tttggatgttgttttggaaaagccgcgatgatcggatcggatttcggattgagttttcaaaaccgaaccgaacc |
19636565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 373 - 458
Target Start/End: Complemental strand, 32055977 - 32055893
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaacc |
458 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||||||||||||| || ||||||||||||| | |||||||||||||||| |
|
|
| T |
32055977 |
aatatttttggatg-tgtttggatgttgttttggcaaaaccgctatgattggttcggatttcggatcacattttcaaaaccgaacc |
32055893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 373 - 464
Target Start/End: Original strand, 25706301 - 25706392
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaa-accgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| |||| |||||||||||||| ||||| ||| ||| | |||||||||||||||| ||||| |
|
|
| T |
25706301 |
aatatttttggatg-tgtttggatgttgttttgaaaaaaaccgctatgatcggttcggacttcagataaccttttcaaaaccgaaccaaaccg |
25706392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 464
Target Start/End: Original strand, 1030476 - 1030551
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccg |
464 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||||||| |||| | ||||| |||||||||| ||||| |
|
|
| T |
1030476 |
gtttggatgttgttttgtaaaaaccgctaagatcggatcggattttggatcactttttcgaaaccgaaccaaaccg |
1030551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 3151743 - 3151779
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151743 |
aattttaggctaaaatatggttttagtccctgcaaat |
3151779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 250 - 294
Target Start/End: Original strand, 3830119 - 3830163
Alignment:
| Q |
250 |
atgaaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3830119 |
atgaaataaatattaggctaaaatatggttttagtccctgcaaat |
3830163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 390 - 458
Target Start/End: Complemental strand, 39717312 - 39717244
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaacc |
458 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||| |||||||| |||| | |||| ||||||||||| |
|
|
| T |
39717312 |
tttggatgttgtattggaaaaaccgctatgatcggttcggattttggatcaccttttgaaaaccgaacc |
39717244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 31869962 - 31869927
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869962 |
attttaggctaaaatatggttttagtccctgcaaat |
31869927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 21159822 - 21159788
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21159822 |
ttttaggctaaaatatggttttagtccctgcaaat |
21159788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 22155924 - 22155958
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155924 |
ttttaggctaaaatatggttttagtccctgcaaat |
22155958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 51834947 - 51834913
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51834947 |
ttttaggctaaaatatggttttagtccctgcaaat |
51834913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 3152115 - 3152082
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3152115 |
tttaggctaaaatatggttttagtccctgcaaat |
3152082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 3830520 - 3830487
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3830520 |
tttaggctaaaatatggttttagtccctgcaaat |
3830487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 387 - 472
Target Start/End: Complemental strand, 48085390 - 48085305
Alignment:
| Q |
387 |
gtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
|||||||||| |||||||| ||||| || | ||| |||||||||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
48085390 |
gtgtttggatgttgttttgtaaaaagcgatggtatcaaatcggatttcggatcactttttcaaaaccgaaccaaaccgcaaaagta |
48085305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 22008519 - 22008555
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22008519 |
aatttaaggctaaaatatggttttagtccctgcaaat |
22008555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 22016037 - 22016073
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22016037 |
aatttaaggctaaaatatggttttagtccctgcaaat |
22016073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 34238595 - 34238627
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34238595 |
ttaggctaaaatatggttttagtccctgcaaat |
34238627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 39288566 - 39288602
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39288566 |
aatttaaggctaaaatatggttttagtccctgcaaat |
39288602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 52342188 - 52342224
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52342188 |
aattttaggctaaaatatggttttggtccctgcaaat |
52342224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 4513257 - 4513292
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4513257 |
atttaaggctaaaatatggttttagtccctgcaaat |
4513292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 264 - 295
Target Start/End: Complemental strand, 10792971 - 10792940
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10792971 |
aggctaaaatatggttttagtccctgcaaatt |
10792940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 20612908 - 20612869
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20612908 |
attattttaaggctaaaatatggttttagtccctgcaaat |
20612869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 28942523 - 28942554
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28942523 |
taggctaaaatatggttttagtccctgcaaat |
28942554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 29446208 - 29446177
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29446208 |
taggctaaaatatggttttagtccctgcaaat |
29446177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 29955672 - 29955637
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29955672 |
attttaggcttaaatatggttttagtccctgcaaat |
29955637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 30004827 - 30004792
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30004827 |
attttaggcttaaatatggttttagtccctgcaaat |
30004792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 30130156 - 30130187
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30130156 |
taggctaaaatatggttttagtccctgcaaat |
30130187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 37506865 - 37506896
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37506865 |
taggctaaaatatggttttagtccctgcaaat |
37506896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 255 - 294
Target Start/End: Complemental strand, 39288908 - 39288869
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
39288908 |
attaaatttaggctaaaatatggttttaatccctgcaaat |
39288869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 4814539 - 4814569
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaat |
4814569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 4950036 - 4950066
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaat |
4950066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 5345690 - 5345660
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaat |
5345660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 12740902 - 12740936
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
12740902 |
ttttaggctaaaatatggttttggtccctgcaaat |
12740936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 13584368 - 13584338
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaat |
13584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 20611019 - 20611049
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaat |
20611049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 21159452 - 21159482
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaat |
21159482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 26800170 - 26800140
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26800170 |
aggctaaaatatggttttagtccctgcaaat |
26800140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 28427609 - 28427579
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaat |
28427579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 29525104 - 29525134
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaat |
29525134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 30128278 - 30128312
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaa |
293 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30128278 |
attttaggctaaaatatggttttggtccctgcaaa |
30128312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 37507223 - 37507193
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaat |
37507193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 39132911 - 39132877
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
39132911 |
ttttaggctaaaatatggttttggtccctgcaaat |
39132877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 39436717 - 39436747
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaat |
39436747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 39437110 - 39437080
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaat |
39437080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 40169659 - 40169625
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
40169659 |
tttttggctaaaatatggttttagtccctgcaaat |
40169625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 40545559 - 40545593
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
40545559 |
ttttaggctaaaatatggttttggtccctgcaaat |
40545593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 44506581 - 44506611
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44506581 |
aggctaaaatatggttttagtccctgcaaat |
44506611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 47005524 - 47005490
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
47005524 |
ttttaggctaaaatatggttttggtccctgcaaat |
47005490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 51550451 - 51550417
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
51550451 |
ttttaggctaaaatatggttttggtccctgcaaat |
51550417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 51834607 - 51834637
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaat |
51834637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Complemental strand, 52403192 - 52403154
Alignment:
| Q |
256 |
ttaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
52403192 |
ttaattttaggctaaaatatgcttttggtccctgcaaat |
52403154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 275442 - 275471
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaa |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
275442 |
taggctaaaatatggttttagtccctgcaa |
275471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 8510214 - 8510243
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaat |
8510243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 10976978 - 10977007
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaat |
10977007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 15016388 - 15016417
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaat |
15016417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 18175791 - 18175820
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaat |
18175820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 253 - 294
Target Start/End: Complemental strand, 22008902 - 22008861
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
22008902 |
aaattaaattttggctaaaatatggttttggtccctgcaaat |
22008861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 25710870 - 25710841
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaat |
25710841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 257 - 294
Target Start/End: Original strand, 26089722 - 26089759
Alignment:
| Q |
257 |
taattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
26089722 |
taatttttggctaaaatatggttttggtccctgcaaat |
26089759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 30424628 - 30424657
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaat |
30424657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 44802282 - 44802311
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaat |
44802311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 45320642 - 45320675
Alignment:
| Q |
256 |
ttaattttaggctaaaatatggttttagtccctg |
289 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
45320642 |
ttaattttaggttaaaatatggttttagtccctg |
45320675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 53701663 - 53701634
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaat |
53701634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Complemental strand, 3361817 - 3361789
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaat |
3361789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 20405226 - 20405194
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
20405226 |
ttaggctaaaatatggttttggtccctgcaaat |
20405194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Complemental strand, 22156292 - 22156264
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaat |
22156264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 25710507 - 25710539
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
25710507 |
ttaggctcaaatatggttttagtccctgcaaat |
25710539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 28552386 - 28552354
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
28552386 |
ttaggctaaaatatggttttggtccctgcaaat |
28552354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 47433871 - 47433839
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
47433871 |
ttaggctaaaatatggttttggtccctgcaaat |
47433839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 4e-30; HSPs: 59)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 373 - 463
Target Start/End: Original strand, 16672012 - 16672102
Alignment:
| Q |
373 |
aatatttttggatggtgt-ttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
463 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16672012 |
aatatttttggatg-tgtgttggatgttgttttggaaaaactgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaacc |
16672102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 389 - 469
Target Start/End: Complemental strand, 21352401 - 21352321
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaa |
469 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||||||| |||| | |||||||||||| ||||| |||||||| |
|
|
| T |
21352401 |
gtttggatgttgttttgtaaaaaccgctaagatcggatcggattttggatcactttttcaaaaccgtaccgagccgcaaaa |
21352321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 255 - 294
Target Start/End: Original strand, 43597144 - 43597183
Alignment:
| Q |
255 |
attaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43597144 |
attaattttaggctaaaatatggttttagttcctgcaaat |
43597183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 25977858 - 25977899
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
25977858 |
aaattaattttaggctaaaatatgtttttggtccctgcaaat |
25977899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 10664981 - 10665013
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10664981 |
ttaggctaaaatatggttttagtccctgcaaat |
10665013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 38639409 - 38639441
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38639409 |
ttaggctaaaatatggttttagtccctgcaaat |
38639441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 44985614 - 44985650
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44985614 |
aattttagactaaaatatggttttagtccctgcaaat |
44985650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 10671943 - 10671912
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10671943 |
taggctaaaatatggttttagtccctgcaaat |
10671912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 11788418 - 11788387
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11788418 |
taggctaaaatatggttttagtccctgcaaat |
11788387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 24358610 - 24358645
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24358610 |
attttaggctaaaatatggttttggtccctgcaaat |
24358645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 26239162 - 26239131
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaat |
26239131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 33732856 - 33732891
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33732856 |
atttaaggctaaaatatggttttagtccctgcaaat |
33732891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 40302341 - 40302310
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40302341 |
taggctaaaatatggttttagtccctgcaaat |
40302310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 262 - 293
Target Start/End: Complemental strand, 42358874 - 42358843
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42358874 |
ttaggctaaaatatggttttagtccctgcaaa |
42358843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 43788856 - 43788887
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43788856 |
taggctaaaatatggttttagtccctgcaaat |
43788887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 44073813 - 44073778
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44073813 |
atttaaggctaaaatatggttttagtccctgcaaat |
44073778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 7814742 - 7814708
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7814742 |
ttttaggctaaaatatgattttagtccctgcaaat |
7814708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 14003404 - 14003438
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
14003404 |
ttttaggctaaaatatggttttggtccctgcaaat |
14003438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 16900207 - 16900177
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaat |
16900177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 16993598 - 16993568
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaat |
16993568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 373 - 431
Target Start/End: Original strand, 18511557 - 18511614
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggat |
431 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| ||||||||||| || || |||||| |
|
|
| T |
18511557 |
aatatttttggatg-tgtttggatgttgttttggcaaaaccgctataattggttcggat |
18511614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 19183781 - 19183811
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaat |
19183811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 19184152 - 19184122
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaat |
19184122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 20131312 - 20131346
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
20131312 |
ttttaggctaaaatatggttttggtccctgcaaat |
20131346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 22881612 - 22881642
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaat |
22881642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Original strand, 23989833 - 23989867
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23989833 |
ttttaggctaaaatatgattttagtccctgcaaat |
23989867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 24483892 - 24483862
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaat |
24483862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 26814230 - 26814200
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaat |
26814200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 27310875 - 27310905
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaat |
27310905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 37271738 - 37271768
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaat |
37271768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 37272103 - 37272073
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaat |
37272073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 38980254 - 38980224
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaat |
38980224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 40301974 - 40302004
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaat |
40302004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 41693673 - 41693703
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaat |
41693703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 41791317 - 41791283
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
41791317 |
tttttggctaaaatatggttttagtccctgcaaat |
41791283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 5790899 - 5790870
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaat |
5790870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 9195054 - 9195083
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaat |
9195083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 257 - 294
Target Start/End: Complemental strand, 9195214 - 9195177
Alignment:
| Q |
257 |
taattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
9195214 |
taattgtaggctaaaatatggttttagaccctgcaaat |
9195177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 10375069 - 10375040
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaat |
10375040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 11713485 - 11713514
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaat |
11713514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 257 - 294
Target Start/End: Original strand, 15531021 - 15531058
Alignment:
| Q |
257 |
taattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
15531021 |
taattttaggctaaaatatgtttttggtccctgcaaat |
15531058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 25705453 - 25705420
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
25705453 |
tttaggctaaaatatggttttggtccctgcaaat |
25705420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 26813866 - 26813895
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaat |
26813895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 264 - 293
Target Start/End: Complemental strand, 29311629 - 29311600
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29311629 |
aggctaaaatatggttttagtccctgcaaa |
29311600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 33733241 - 33733212
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaat |
33733212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 36622250 - 36622279
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaat |
36622279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 38979889 - 38979918
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaat |
38979918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 44985988 - 44985955
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
44985988 |
tttaggctaaaatatggttttaatccctgcaaat |
44985955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 3671000 - 3671032
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
3671000 |
ttaggctaaaatatggttttagtccatgcaaat |
3671032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Complemental strand, 3838263 - 3838235
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaat |
3838235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 254 - 294
Target Start/End: Original strand, 4423884 - 4423924
Alignment:
| Q |
254 |
aattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
4423884 |
aattgatttaaggctaaaatatggttttggtccctgcaaat |
4423924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 266 - 294
Target Start/End: Original strand, 10374775 - 10374803
Alignment:
| Q |
266 |
gctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaat |
10374803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 254 - 294
Target Start/End: Original strand, 15842450 - 15842490
Alignment:
| Q |
254 |
aattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||| ||||| |||||||||||||| |||||||||||| |
|
|
| T |
15842450 |
aattaatattaggttaaaatatggttttggtccctgcaaat |
15842490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 16673774 - 16673742
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
16673774 |
ttaggctaaaatatggttttggtccctgcaaat |
16673742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Complemental strand, 20658412 - 20658380
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
20658412 |
ttaggctaaaatatggttttaatccctgcaaat |
20658380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 398 - 458
Target Start/End: Original strand, 22596099 - 22596159
Alignment:
| Q |
398 |
ttgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaacc |
458 |
Q |
| |
|
|||||||| ||||| ||||| |||| ||||||||||||||| | ||||||||||| |||| |
|
|
| T |
22596099 |
ttgttttgtaaaaatcgctaagatcagatcggatttcggatcactttttcaaaaccaaacc |
22596159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 402 - 458
Target Start/End: Original strand, 34439868 - 34439924
Alignment:
| Q |
402 |
tttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaacc |
458 |
Q |
| |
|
|||| ||||||||||| || |||||||||| |||||| | |||||||||||||||| |
|
|
| T |
34439868 |
tttgtaaaaaccgctagaattggatcggattccggattactttttcaaaaccgaacc |
34439924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 254 - 294
Target Start/End: Complemental strand, 41694014 - 41693974
Alignment:
| Q |
254 |
aattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
41694014 |
aatttatttttggctaaaatatgattttagtccctgcaaat |
41693974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 43592043 - 43592075
Alignment:
| Q |
262 |
ttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
43592043 |
ttaggctaaaatatggttttagtccttgcaaat |
43592075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 373 - 473
Target Start/End: Complemental strand, 47862 - 47763
Alignment:
| Q |
373 |
aatatttttggatggtgtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagta |
472 |
Q |
| |
|
||||||| |||||| ||||||||| |||||||| ||||| |||||||||| ||||||||||||||| | || ||||||||||| | || |||||||||| |
|
|
| T |
47862 |
aatatttgtggatg-tgtttggatgttgttttgtaaaaatcgctatgatcagatcggatttcggatcactttctcaaaaccgaatcaaatcgcaaaagta |
47764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 4035 - 4070
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4035 |
attttaggctaaaatatggttttagtccctgcaaat |
4070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 259 - 294
Target Start/End: Original strand, 19217 - 19252
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19217 |
attttaggctaaaatatggttttagtccctgcaaat |
19252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0396 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0396
Description:
Target: scaffold0396; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 390 - 456
Target Start/End: Complemental strand, 1356 - 1290
Alignment:
| Q |
390 |
tttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaa |
456 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||| |||||||||||||| | ||||||||| |||| |
|
|
| T |
1356 |
tttggatattgttttgtaaacaccgctaagatcgaatcggatttcggatcactttttcaaaatcgaa |
1290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 34; Significance: 0.0000000007; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 5387 - 5428
Alignment:
| Q |
253 |
aaattaattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5387 |
aaattaattaaaggctaaaatatggttttagtccctgcaaat |
5428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 5709 - 5679
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaat |
5679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Original strand, 14695 - 14726
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaat |
14726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 15013 - 14983
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaat |
14983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 294
Target Start/End: Complemental strand, 10517 - 10486
Alignment:
| Q |
263 |
taggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10517 |
taggctaaaatatggttttagtccctgcaaat |
10486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 10168 - 10197
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaat |
10197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 294
Target Start/End: Complemental strand, 366279 - 366244
Alignment:
| Q |
259 |
attttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
366279 |
atttaaggctaaaatatggttttagtccctgcaaat |
366244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 2777 - 2807
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaat |
2807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 1310 - 1340
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaat |
1340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 5208 - 5238
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaat |
5238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 5228 - 5258
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaat |
5258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 2665 - 2631
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
2665 |
ttttaggctaaaatatggttttggtccctgcaaat |
2631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 290 - 260
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaat |
260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 290
Target Start/End: Complemental strand, 18048 - 18018
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18048 |
ttttaggctaaaatatggttttagtccctgc |
18018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 31; Significance: 0.00000005; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 3919 - 3889
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaat |
3889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 3532 - 3561
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaat |
3561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 31; Significance: 0.00000005; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Original strand, 8329 - 8359
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaat |
8359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 8643 - 8613
Alignment:
| Q |
264 |
aggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8643 |
aggctaaaatatggttttagtccctgcaaat |
8613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 260 - 294
Target Start/End: Complemental strand, 223177 - 223143
Alignment:
| Q |
260 |
ttttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
223177 |
ttttaggctaaaatatggttttggtccctgcaaat |
223143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 9028 - 8999
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaat |
8999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 4312 - 4283
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaat |
4283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 12525 - 12554
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaat |
12554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 3295 - 3262
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
3295 |
tttaggctaaaatatggttttaatccctgcaaat |
3262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 27368 - 27335
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
27368 |
tttaggctaaaatatggttttggtccctgcaaat |
27335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 17966 - 17937
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaat |
17937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 75768 - 75735
Alignment:
| Q |
261 |
tttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
75768 |
tttaggctaaaatatggttttggtccctgcaaat |
75735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 75352 - 75388
Alignment:
| Q |
258 |
aattttaggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
75352 |
aattttaggctaaaatatggttttgctccctgcaaat |
75388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 294
Target Start/End: Original strand, 12182 - 12211
Alignment:
| Q |
265 |
ggctaaaatatggttttagtccctgcaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaat |
12211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 389 - 473
Target Start/End: Original strand, 15505 - 15589
Alignment:
| Q |
389 |
gtttggatattgttttggaaaaaccgctatgatcggatcggatttcggattgcgttttcaaaaccgaaccgaaccgcaaaagtaa |
473 |
Q |
| |
|
|||||| | |||||||| ||||| |||| |||||||| |||||||||| | ||||||||||| ||||| |||| |||||||| |
|
|
| T |
15505 |
gtttggttgttgttttgtaaaaatagctaggatcggattagatttcggataactttttcaaaaccaaaccggaccgtaaaagtaa |
15589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University