View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3705_low_23 (Length: 217)
Name: NF3705_low_23
Description: NF3705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3705_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 6151058 - 6150859
Alignment:
| Q |
1 |
ggaagctattcccttgatccagtccagctctatgattttcnnnnnnnagggaagattcacgtctatgatgtcaagactaacattcgcattggtttgcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6151058 |
ggaagctattcccttgatccagtccagctctatgattttctttttttagggaagattcacgtctatgatgtcaagactaacattcgcattggtttgcttc |
6150959 |
T |
|
| Q |
101 |
gtgttggcaaggtcgttgaaagtacaacatggcagccacctagctcggattggatcggtcttaatgtggataatgaatcggtcttaatatgggtaatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6150958 |
gtgttggcaaggtcgttgaaagtacaacatggcagccacctagctcggattggaacggtcttaatgtggataatggatcggtcttaatatgggtaatatt |
6150859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University