View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3705_low_24 (Length: 215)
Name: NF3705_low_24
Description: NF3705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3705_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 33501447 - 33501629
Alignment:
| Q |
15 |
cataggagaagaaaaaatggga--ggaattagtggcttacactgtagaatgcactataataatatatttgataataatatagtatacttgattggaaaat |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33501447 |
cataggagaagaaaaaatgggaaaggaattagtggcttacactgtagaatgcactataataatat--ttgataataatatagtatacttgattggaaaat |
33501544 |
T |
 |
| Q |
113 |
gtgacttattggaatgatttcttgttgctataacagattgacaatgatcttggctccattgttgaaaagtgagcactcagaaaat |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33501545 |
gtgacctattggaatgatttcttgttgctataacagattgacaatgatcttggctccattgttgaaaagtgagcactcagaaaat |
33501629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University