View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3705_low_9 (Length: 339)
Name: NF3705_low_9
Description: NF3705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3705_low_9 |
 | |
|
| [»] scaffold0171 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 43 - 327
Target Start/End: Original strand, 36734113 - 36734397
Alignment:
| Q |
43 |
agccaaacttgtagtgaaaatgatggtgaagctgaagaggtgaggaagttggtgcaagacactgtacatcttacggggaagtttaatatttctgatttta |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734113 |
agccaaacttgtagtgaaaatgatggtgaagctgaagaggtgaggaagttggtgcaagacactgtacatcttacggggaagtttaatatttctgatttta |
36734212 |
T |
|
| Q |
143 |
tttggttttttaagaactgggatgtccaggggtttagcaaagggttaaaggaaattagggacaggtttgattctatgatggagaggattatcaaggagca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734213 |
tttggttttttaagaactgggatgtccaggggtttagcaaagggttagaggaaattagggacaggtttgattctatgatggagaggattatcaaggagca |
36734312 |
T |
|
| Q |
243 |
tcaagaagtaaggaggaggagaaaggaagttggtggaggagaaggtcaaattaaggatctacttgatattttattggatattctt |
327 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734313 |
tcaagaagtaaggaggaggagaaaagaagttggtggaggagaaggtcaaattaaggatctacttgatattttattggatattctt |
36734397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 27017893 - 27017860
Alignment:
| Q |
1 |
attttccctaaacgtattcagccgaggttgttag |
34 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
27017893 |
attttccctaaacgtattcagccaaggttgttag |
27017860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 165
Target Start/End: Original strand, 18973 - 19053
Alignment:
| Q |
85 |
aggaagttggtgcaagacactgtacatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggat |
165 |
Q |
| |
|
|||||| |||||||||| | |||| | ||| | |||| ||||||| | || ||||||||||||||||||||||| |||||| |
|
|
| T |
18973 |
aggaagatggtgcaagatagtgtagagctttcagggaggtttaatttgtcggattttatttggttttttaagaattgggat |
19053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University