View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3706_high_17 (Length: 279)
Name: NF3706_high_17
Description: NF3706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3706_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 6491612 - 6491368
Alignment:
| Q |
1 |
tacttttgatgtatggtcttgtccaatctggatatgaatccttattattaaagcacggtttgtatnnnnnnnnntcttagttggtgctgagaaaatgaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6491612 |
tacttttgatgtatggtcttgtccaatctggatatgaatccttattattaaagcacggtttgtataaaaaaaa-tcttagttggtgctgagaaaatgaac |
6491514 |
T |
 |
| Q |
101 |
ttctttcacaagggttctagtattatccaacaatgttttcaccgtcgtcgtcgtccctaatttgagcat--------tccatatgaagtgaacaaaatga |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6491513 |
ttatttcacaagggttctagtattatccaacaatgtattcaccgtcgt---cgtccctaatttgagcatattgatcctccatatgaagtgaacaaaatga |
6491417 |
T |
 |
| Q |
193 |
tataatgataaatttcaagcaaattggtataaatttgttcgattctact |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491416 |
tataatgataaatttcaagcaaattggtataaatttgttcgattctact |
6491368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University