View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3706_low_25 (Length: 254)
Name: NF3706_low_25
Description: NF3706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3706_low_25 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 37565677 - 37565439
Alignment:
| Q |
19 |
tataaaacatacatttctccaaagtttgggaccctgctctccaattttccttgactttaaaggcagcaaaatctgccacatgatgaattagagaacgcgt |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37565677 |
tataaaacttacatttctccaaagtttgggaccctgctctccaattttccttgactttaaaggcatcaaaatctgccacatgatgaattagagaacgcgt |
37565578 |
T |
 |
| Q |
119 |
tgacaaattaaactcacttgcatagcttaatatcatgctacattggtaacctctcatcatcatcgtcggaagagg---aggaactaaagtcgtgtattct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37565577 |
tgacaaattaaactcacttgcatagcttaatatcatgctacgttggtaacctctcatcatcatcgtcggaagaggaggaggaactaaagtcgtgtattct |
37565478 |
T |
 |
| Q |
216 |
tctctctgctatggctggaaatagtctcctatgcatatc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37565477 |
tctctctgctatggctggaaatagtctcctatgcatatc |
37565439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University