View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3706_low_26 (Length: 252)
Name: NF3706_low_26
Description: NF3706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3706_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 41066803 - 41067042
Alignment:
| Q |
1 |
aagaagtgacaaatggacagcgaaaacgacgccgaattgaatgaaatattgatgcaaagcttttcaaccttgcgacgtgaagaaaacgacggtgccgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066803 |
aagaagtgacaaatggacagcgaaaacgacgccgaattgaatgaaatattgatgcaaagcttttcaaccttgcgacgtgaagaaaacgacggtgccgctt |
41066902 |
T |
 |
| Q |
101 |
ggtggtgccaccgtacgctaccttccaccatcttcccaaaaggacattgtatccttcacctccttcatcttcctcttcctcttactcacgatcgaacaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41066903 |
ggtggtgccaccgtacgctaccttccaccatcttcccaaaacgacattgtatccttcacctccttcatcttcctcatcctcttactcacgatcgaacaca |
41067002 |
T |
 |
| Q |
201 |
attcccattctgaacggtgatgtattcttttccttctttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41067003 |
attcccattctgaacggtgatgtattcttttccttctttt |
41067042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University