View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3706_low_28 (Length: 242)
Name: NF3706_low_28
Description: NF3706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3706_low_28 |
 |  |
|
| [»] scaffold0450 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0450 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 9627 - 9403
Alignment:
| Q |
18 |
attgctggtagacgcaccatccttcaatgagtttttcgcttgaaaaagtgaagggtttgatgaattgctagtagaagcaccatcattgaaggagtttttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9627 |
attgctggtagacgcaccatccttcaatgagtttttcgcttgaaaaagtgaagggtttgatgaattgctagtagaagcaccatcattgaaggagtttttc |
9528 |
T |
 |
| Q |
118 |
gcttgaaaaactgaaaggtttgaatatcgtctgttttttcttctttctgcgatttcattgatgacagaaattggaagatccgatgaaaattttgaattta |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9527 |
gcctgaaaaactgaaaggtttgaatatcgtctgttttttcttctttctgcgatttcattgacgacagaaattggaagatccgatgcaaattttgaattta |
9428 |
T |
 |
| Q |
218 |
aagctctctgagaaactcctccttc |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9427 |
aagctctctgagaaactcctccttc |
9403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 43 - 140
Target Start/End: Complemental strand, 9665 - 9568
Alignment:
| Q |
43 |
aatgagtttttcgcttgaaaaagtgaagggtttgatgaattgctagtagaagcaccatcattgaaggagtttttcgcttgaaaaactgaaaggtttga |
140 |
Q |
| |
|
|||||||| || ||||||||||||||| |||||||||||||||| ||||| |||||||| || || ||||||||||||||||||| |||| ||||||| |
|
|
| T |
9665 |
aatgagttatttgcttgaaaaagtgaaaggtttgatgaattgctggtagacgcaccatccttcaatgagtttttcgcttgaaaaagtgaagggtttga |
9568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 75 - 141
Target Start/End: Original strand, 8762367 - 8762433
Alignment:
| Q |
75 |
tgatgaattgctagtagaagcaccatcattgaaggagtttttcgcttgaaaaactgaaaggtttgaa |
141 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| |||||||| |||||||||| || |||||||||| |
|
|
| T |
8762367 |
tgatgaaaagctagtggaagcaccatcattgaatgagttttttgcttgaaaaaatggaaggtttgaa |
8762433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 141
Target Start/End: Original strand, 8788898 - 8788964
Alignment:
| Q |
75 |
tgatgaattgctagtagaagcaccatcattgaaggagtttttcgcttgaaaaactgaaaggtttgaa |
141 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||| ||| |||| |||||||||| || |||||||||| |
|
|
| T |
8788898 |
tgatgaaaagctagtggaagcaccatcatggaatgaggtttttgcttgaaaaaatggaaggtttgaa |
8788964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University