View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_13 (Length: 318)
Name: NF3707_high_13
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 41588229 - 41587923
Alignment:
| Q |
1 |
atccggcgaggagacagtcaatgtgttagaagaacaaggtgctgcagttgcaagtggtgatggtgtggagaggacattcaagcggactacacggtctgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
41588229 |
atccggcgaggagacagtcaatgtgttagaagaacaaggtgctgcagttgcaagtggtgatggtgtggggaggacattcaatcggactatgcggtctgca |
41588130 |
T |
|
| Q |
101 |
actatgaaagcaaatgctgggtccggtgaggagacagtgacgaagttagaccaaaaaggtgctgctgctgttgagagtgaaattgatggtgcattagctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41588129 |
actatgaaagcaaatgctgggtccggtgaggagacagtgacgaagttagaccaagaaggtgct---gctgttgagagtgaaattgatggtgcattagctg |
41588033 |
T |
|
| Q |
201 |
ttcggagaaacaagatggagttgaagatgtcgaagaagattgcagttgataagaagcggcctacaacaatgaaggagctctttcgtaccggtttactcga |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41588032 |
ttcggagaaacaagatggagttgaagacgtcgaagaagattgcagttgataagaagcggcctacaacaatgaaggagctctttcgtaccggtttactcga |
41587933 |
T |
|
| Q |
301 |
tagtgtctct |
310 |
Q |
| |
|
| |||||||| |
|
|
| T |
41587932 |
tggtgtctct |
41587923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 41588336 - 41588294
Alignment:
| Q |
23 |
gtgttagaagaacaaggtgctgcagttgcaagtggtgatggtg |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
41588336 |
gtgttagaacaacaaggtgctgcagttgcaactggtaatggtg |
41588294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University