View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_14 (Length: 307)
Name: NF3707_high_14
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 66 - 116
Target Start/End: Complemental strand, 11662826 - 11662776
Alignment:
| Q |
66 |
ttattatccaataatgtgaatgaagttccaagtaataatacactttcttgt |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11662826 |
ttattatcaaataatgtgaatgaagttccaagtaataatacactttcttgt |
11662776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 62
Target Start/End: Complemental strand, 11662912 - 11662854
Alignment:
| Q |
4 |
gggtagattattctctagtttaaaaatatattgtggcgtctagtttactgtttatttgc |
62 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
11662912 |
gggtaaattattttctagtttaaaaatatattgtggcgtcaagtttgctgtttatttgc |
11662854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 116
Target Start/End: Original strand, 7345552 - 7345602
Alignment:
| Q |
66 |
ttattatccaataatgtgaatgaagttccaagtaataatacactttcttgt |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
7345552 |
ttattatccaataatgtgaatgaatttccaagtaataaactactttcttgt |
7345602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University