View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_16 (Length: 276)
Name: NF3707_high_16
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 54114112 - 54113863
Alignment:
| Q |
19 |
gctctgacttgtttttcccattgaattccaccccacgaagcggagagataccggctaccggaatcaacgacgccttgaaaagtgacgtaagaaacagttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54114112 |
gctctgacttgtttttcccattgaattccaccccatgaagcggagagataccggctaccggaatcaacgacgccttgaaaagtgacgtaagaaacagttg |
54114013 |
T |
 |
| Q |
119 |
atgcgataagcaaaagcgcccacaagaacatggtgcttgatgaaccgaaacaacggtgaacctgacgattcattagaccgtggtttctttcgatcttgaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54114012 |
atgcgataagcaaaagcgcccacaagaacatggtgcttgatgaaccgaaacaacggtgaacctgacggttcattagaccgtggtttctttcgatcttgaa |
54113913 |
T |
 |
| Q |
219 |
ttttcctggtgtagatgggtagagttggtcttccaatgaagatgatgatg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54113912 |
ttttcctggtgtagatgggtagagttggtcttccaatgaagatgatgatg |
54113863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University